Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 641

2 members and 639 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 89

Threaded View

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Freaking out!! Fire to Normal makes white snake?!!

    Quote Originally Posted by asplundii View Post
    In the link Hooblah posted there is a post by me that has a second link which explains the "null" phenomenon. The "mechanism" is really very simple; a second copy of the gene (in this case the WT copy) is simply missing, by way of any of a number of means.

    Here. Save you the time having to hunt it down:

    http://www.reptileradio.net/ball-pyt...tml#post769750
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    h00blah (05-19-2013),Redemption Reptiles (05-17-2013)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1