» Site Navigation
1 members and 1,520 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,073
Threads: 249,220
Posts: 2,572,808
Top Poster: JLC (31,651)
|
-
Re: Has anyone crossed these yet?
 Originally Posted by Watever
Well, first, I am sorry if you don't understand. My first language is french and not english, when I typed it yesterday it was late and it was just after a long day at work and university and watching a hockey game (with some beers).
No need to apologize, I just wanted to make sure I was not missing something, which it seems I was.
I was trying to say that a albinism gene (T-) can differ from one species to another.
That geneticly they doesn't look the same (chromosome) but their effect are the same on the animal (not produce melamine).
A bit like the Cold virus (I know it's not a gene but it can help you understand what I am trying to say). There is a lot of variation of it, but the effect of it is the same.
The T- in the tiger/alligator/ball/burmese all have the same effect, keep the skin from producing melamine, but I am pretty sure if we were able to look at them under a microscopre, they wouldn't look the same and probably wouldn't been on the same loci.
Making the cross between both species (both showing albinism) not being albinos but het or double het.
Okay, I understand what you are getting at now 
While what you are saying is accurate in a sense it is also incorrect in another sense.
Please allow me to explain.
Ignore for a moment what organism we are talking about. Think only at the level of the enzyme itself.
Tyrosinase, as an enzyme, catalyzes the production of melanin (or other pigments) from tyrosine by way of oxidation.
There are many different structures for tyrosinase enzymes but, in the end, they all do the same thing no matter how different they look from one another.
Now, consider a table top reaction. You have 4 test tubes (call them 1-4), all containing a clear liquid with the necessary bio-reagents to create melanin. All you need is to add a tyrosinase to start the reaction. You also have 2 tubes (A and B), one containing tyrosinase from organism A the other containing tyrosinase from organism B. To tube 1 you add 2 drops of tyrosinase only from tube A the reaction turns brown. To tube 2 you add 2 drops of tyrosinase from only tube B the reaction turns brown. To tube 3 you add one drop from tube A and one drop from tube B and the reaction turns brown. You add nothing to tube 4, that reaction stays clear.
The reason tube 4 stays clear is because there is no tyrosinase to get the reaction going.
Now let us go back to the hybrid snake in question.
The hybrid animal will have one copy of genes from each of its parents. So a wild type ball bred to a wild type burm will generate a hybrid with wild type tyrosinase A from the ball and wild type tyrosinase B from the burm, giving it 2 functional copies of tyrosinase even if both of them are structurally different. This is equivalent to tube 3 in the above experiment.
Change the equation up now using T- albinos as parents. Neither parent has a functional copy of tyrosinase to pass on. So each offspring would get a non-functional A and a non-functional B. With no functional form of tyrosinase the hybrid animal can not catalyze the reaction and will therefore not generate any pigment. This is equivalent to tube 4 in the above experiment.
Make sense?
Also, just a tangent but I would be willing to guess that the tyrosinase in balls and burms is almost identical both structurally and on the DNA level. If you compare the tyrosinase of a human to that of a mouse the proteins are 84% identical. And a ball and a burm are much more closely related than a human and a mouse. 
Cheers
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|