Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 763

0 members and 763 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,108
Posts: 2,572,139
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Page 4 of 4 FirstFirst 1234
Results 31 to 36 of 36

Thread: woma lessers

  1. #31
    Steel Magnolia rabernet's Avatar
    Join Date
    07-12-2005
    Location
    In the Nest
    Posts
    29,196
    Thanks
    2,845
    Thanked 5,584 Times in 3,092 Posts
    Blog Entries
    2
    Images: 46

    Re: woma lessers

    I don't believe that there was only one woma to ever come out of africa. Ball python breeding has been around for decades, and who is to say that they didn't find another WC african woma? How would you know that a normal looking woma wouldn't carry the hidden gene, unless you proved it out by breeding it to a lesser?
    I never said that there was only one woma to come out of Africa. I said it was possible that only one woma with the hidden gene could have come out of Africa.

    I'm quite sure when the Soul Sucker was first produced that most people who had woma's and lessers in their collections have tried and failed to re-produce it. Why has no one else produced it? Hidden gene woma.


    Along w/ that, how would kevin have known that a woma x lesser made a soul sucker? In his earlier days he could have been trying to produce something else w/ a woma, and instead sold the "hidden gene" womas by accident as normal looking womas.
    Well of course he wouldn't know it would make a soul sucker until he produced it. Just like he didn't know he'd make an inferno until he put three genes together. Until the first one is produced, you won't know what you're going to get.

    Kevin has told me that hidden gene womas have markers that set them apart from "normal" woma's. That's how he knew it was different. Kevin is a professional with years of experience and an eye to be able to tell when an animal is special or different from the norm.


    I think the "hidden gene" theory is just BS. I think to make a soul sucker it is a combination of genes, like a triple co-dom, rather than 2 co-doms + hidden gene.
    You are entitled to your opinion. However, knowing Kevin and Kara as I do as friends, I will choose to believe what they tell me is true. And I'm so willing to believe it, that I'm also going to be willing to pay MUCH more for a hidden gene woma from Kevin when I'm ready for one, than a "normal" woma.

    I know that the hidden gene is not BS, but if you've decided it is, there's not much that can be said to change your mind.

  2. #32
    BPnet Veteran Oxylepy's Avatar
    Join Date
    10-25-2008
    Location
    Pittsburgh Pennsylvania
    Posts
    2,383
    Thanks
    362
    Thanked 573 Times in 434 Posts

    Re: woma lessers

    Alright but the thing I wanna know is:

    Is it really a "hidden" gene, aka an entirely different gene than the Woma gene, OR is their Woma gene just a higher end mutation. I suppose the only way to know for sure would be to produce combos and breed them off and take tallies of which offspring show the signs of the hidden gene and which offspring show no signs of the hidden gene.

    Also what is all this Soul Sucker 2.0 jazz?

    Oh and by making tallies of which show signs of it I mean: If any of the ones that SHOULD show signs of it do not, then it is a different gene, if you can never produce one that doesn't show signs of it then it should be viewed as a higher end version of the Woma gene.
    Ball Pythons 1.1 Lesser, Pastel
    1.0 Lesser Pastel, 0.0.7 mixed babies

  3. #33
    Registered User
    Join Date
    04-13-2008
    Posts
    12
    Thanks
    1
    Thanked 3 Times in 2 Posts

    Re: woma lessers

    Quote Originally Posted by Oxylepy View Post
    Alright but the thing I wanna know is:

    Is it really a "hidden" gene, aka an entirely different gene than the Woma gene, OR is their Woma gene just a higher end mutation. I suppose the only way to know for sure would be to produce combos and breed them off and take tallies of which offspring show the signs of the hidden gene and which offspring show no signs of the hidden gene.

    Also what is all this Soul Sucker 2.0 jazz?

    Oh and by making tallies of which show signs of it I mean: If any of the ones that SHOULD show signs of it do not, then it is a different gene, if you can never produce one that doesn't show signs of it then it should be viewed as a higher end version of the Woma gene.
    I think you are making some valid points. Its so interesting that people think the "hidden gene" came from the Woma. It DIDNT!! The Woma that sired the Soulsucker was 3nd or 4th generation, produced from a "weird" female.That Female is the Key not the Woma! The woma was first produced by NERD in 1999. THe Soulsucker was made in 2005. The math tells all. And of course, NO ONE has made a soulsucker from lesser to woma. Not Jeremy stone, not BHB, not Snakekeeper, etc. And those are from Woma's that came from Nerd.

  4. The Following 2 Users Say Thank You to roadrunner For This Useful Post:

    grunt_11b (02-07-2009),joshthaxton (02-07-2009)

  5. #34
    Registered User joshthaxton's Avatar
    Join Date
    12-03-2008
    Location
    Fayetteville NC
    Posts
    154
    Thanks
    46
    Thanked 16 Times in 12 Posts

    Re: woma lessers

    Quote Originally Posted by roadrunner View Post
    I think you are making some valid points. Its so interesting that people think the "hidden gene" came from the Woma. It DIDNT!! The Woma that sired the Soulsucker was 3nd or 4th generation, produced from a "weird" female.That Female is the Key not the Woma! The woma was first produced by NERD in 1999. THe Soulsucker was made in 2005. The math tells all. And of course, NO ONE has made a soulsucker from lesser to woma. Not Jeremy stone, not BHB, not Snakekeeper, etc. And those are from Woma's that came from Nerd.
    I couldn't have stated it better myself, thanks


  6. #35
    BPnet Veteran Bill Buchman's Avatar
    Join Date
    12-30-2007
    Location
    So Cal
    Posts
    957
    Thanks
    324
    Thanked 287 Times in 206 Posts
    Images: 80

    Re: woma lessers

    Even more perplexing than the mysterious ingredients of the Soul Sucker, is that one of the great marketing strategies in ANY market has gone unnoticed!!!

    I would argue that it matters less whether or not we know/think we know what any of Kevin's "clandestine gene combos" truly are. Mattering most is that we continue to revisit any number of Kevin's creations to ponder their ingredients!!!

    Truth be told, most would agree there are more than a few morphs and combos equal to NERDS in visual beauty. I find no less than a dozen that I find MORE attractive/compelling to my eye.

    However, it is the "cloak of mysterious ingredients" that Kevin's animals wear that DEMANDS our attention. As the saying goes, "Any pub is good pub -- just make sure you spell the name right."

    A valuable lesson learned for this beginning breeder -- BIG TIME!!! Withheld ingredients = high project interest!!! The Evil Morph God is without question a breeding visionary. Moreover, I would humbly submit that he sits alone atop Mount Olympus when it comes to project marketing and management...
    Bill Buchman

  7. The Following User Says Thank You to Bill Buchman For This Useful Post:

    grunt_11b (02-08-2009)

  8. #36
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: woma lessers

    Thank you for that background, I was not aware of any of that info. Just going off what Kevin said on Reptile Radio I got the impression they were the same "hidden" gene. What you say would indicate otherwise.

    More projects for the genetics mill...


    Quote Originally Posted by jluman View Post
    A few more things:

    The hidden gene in the woma is not the same as the hidden gene in the platinum. A few years ago NERD was selling lessers that were hidden gene (from the woma/soulsucker) carriers. If the hidden gene from the platinum was involved, the lesser couldn't carry it. With that gene, a snake can be a lesser, or a hidden gene carrier, if both genes are present it would be a visual platinum.

    The hidden gene in the woma or platinum lines isn't the same as what makes the crystals. BHB has produced snakes that look very similar to crystal using lessers. Here's a pic, from EBN's site again.

    http://www.exoticsbynature.com/daytona06/bhb4.jpg

    Also, Tom Baker produced a super of the morph that makes crystals when bred to a mojave. RDR produced I think 40+ eggs from hiden gene carrier to hidden gene carrier breedings and didn't get any visual morphs.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 4 of 4 FirstFirst 1234

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1