» Site Navigation
0 members and 804 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,105
Posts: 2,572,113
Top Poster: JLC (31,651)
|
-
Re: Parthenogenesis?
 Originally Posted by NicoleG
So, I have a questionable partho clutch also. I just want to clarify… if mom is a YB, will the babies all be YBs, or Super YBs?
From what I understand, it would be like breeding the female to herself in punnet squares.
So YB x YB =
25% Super YB
50% YB
25% Normal
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
The Following User Says Thank You to nikkubus For This Useful Post:
-
Re: Parthenogenesis?
 Originally Posted by nikkubus
From what I understand, it would be like breeding the female to herself in punnet squares.
So YB x YB =
25% Super YB
50% YB
25% Normal
I think that's the right way to look at it, & explains why the 3 rat snakes I hatched out from apparent parthenogenesis are all very different. The 'mom' is a c/b cross of Yellow & Gulf Hammock rat snakes, & likely something else (Everglades +++)- or what I call a Florida mix, having spoke to the source when I acquired the 4 "Florida" rat snakes as 1.5 year-olds. Thanks.
Rudeness is the weak man's imitation of strength.
Eric Hoffer (1902 - 1983)
“The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi
-
The Following User Says Thank You to Bogertophis For This Useful Post:
-
Re: Parthenogenesis?
 Originally Posted by NicoleG
I just want to clarify… if mom is a YB, will the babies all be YBs, or Super YBs?
Incorrect.
If mom is a YB and goes partho then she will produce only normals and Ivories. You will not get YBs from a partho clutch
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
Armiyana (08-10-2023),Bogertophis (08-09-2023),Homebody (08-11-2023)
-
Re: Parthenogenesis?
 Originally Posted by asplundii
Incorrect.
If mom is a YB and goes partho then she will produce only normals and Ivories. You will not get YBs from a partho clutch
So it has something to do with the egg self-fertilizing from whatever genetic info got sent to that specific egg? So each egg can be different, but every single allele is homozygous?
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
-
Re: Parthenogenesis?
 Originally Posted by nikkubus
So each egg can be different, but every single allele is homozygous?
Pretty much, yes
.
.
.
 Originally Posted by nikkubus
So it has something to do with the egg self-fertilizing from whatever genetic info got sent to that specific egg?
The second polar body fuses back in with the egg
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
Erie_herps (08-11-2023),Homebody (08-11-2023),nikkubus (08-11-2023)
-
All of the hatchlings should be the same sex as well, females in BPs IIRC?
As far as additional info for NicoleG:
The downside being that if they're partho, the likelyhood of them thriving decreases over time. They may hatch and do well for a while, but a lot of partho babies can start failing around the age of maturity (typically 2 years in BPs). This is why you may see breeders listing that the baby was partho in their info as well.
Last edited by Armiyana; 08-10-2023 at 12:04 PM.
-
The Following 5 Users Say Thank You to Armiyana For This Useful Post:
Alicia (08-10-2023),Bogertophis (08-10-2023),Erie_herps (08-11-2023),Homebody (08-11-2023),nikkubus (08-11-2023)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|