Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 635

0 members and 635 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,105
Posts: 2,572,114
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 2 of 2 FirstFirst 12
Results 11 to 16 of 16
  1. #11
    BPnet Veteran nikkubus's Avatar
    Join Date
    12-20-2018
    Posts
    1,370
    Thanks
    2,509
    Thanked 1,848 Times in 973 Posts

    Re: Parthenogenesis?

    Quote Originally Posted by NicoleG View Post
    So, I have a questionable partho clutch also. I just want to clarify… if mom is a YB, will the babies all be YBs, or Super YBs?
    From what I understand, it would be like breeding the female to herself in punnet squares.
    So YB x YB =
    25% Super YB
    50% YB
    25% Normal
    7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose

  2. The Following User Says Thank You to nikkubus For This Useful Post:

    Bogertophis (08-09-2023)

  3. #12
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,789
    Thanks
    29,346
    Thanked 20,562 Times in 12,287 Posts

    Re: Parthenogenesis?

    Quote Originally Posted by nikkubus View Post
    From what I understand, it would be like breeding the female to herself in punnet squares.
    So YB x YB =
    25% Super YB
    50% YB
    25% Normal
    I think that's the right way to look at it, & explains why the 3 rat snakes I hatched out from apparent parthenogenesis are all very different. The 'mom' is a c/b cross of Yellow & Gulf Hammock rat snakes, & likely something else (Everglades +++)- or what I call a Florida mix, having spoke to the source when I acquired the 4 "Florida" rat snakes as 1.5 year-olds. Thanks.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  4. The Following User Says Thank You to Bogertophis For This Useful Post:

    nikkubus (08-09-2023)

  5. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Parthenogenesis?

    Quote Originally Posted by NicoleG View Post
    I just want to clarify… if mom is a YB, will the babies all be YBs, or Super YBs?
    Incorrect.

    If mom is a YB and goes partho then she will produce only normals and Ivories. You will not get YBs from a partho clutch
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Armiyana (08-10-2023),Bogertophis (08-09-2023),Homebody (08-11-2023)

  7. #14
    BPnet Veteran nikkubus's Avatar
    Join Date
    12-20-2018
    Posts
    1,370
    Thanks
    2,509
    Thanked 1,848 Times in 973 Posts

    Re: Parthenogenesis?

    Quote Originally Posted by asplundii View Post
    Incorrect.

    If mom is a YB and goes partho then she will produce only normals and Ivories. You will not get YBs from a partho clutch
    So it has something to do with the egg self-fertilizing from whatever genetic info got sent to that specific egg? So each egg can be different, but every single allele is homozygous?
    7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose

  8. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Parthenogenesis?

    Quote Originally Posted by nikkubus View Post
    So each egg can be different, but every single allele is homozygous?
    Pretty much, yes
    .
    .
    .
    Quote Originally Posted by nikkubus View Post
    So it has something to do with the egg self-fertilizing from whatever genetic info got sent to that specific egg?
    The second polar body fuses back in with the egg
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Erie_herps (08-11-2023),Homebody (08-11-2023),nikkubus (08-11-2023)

  10. #16
    BPnet Senior Member
    Join Date
    06-07-2018
    Posts
    1,075
    Thanks
    1,474
    Thanked 2,015 Times in 890 Posts
    Images: 7
    All of the hatchlings should be the same sex as well, females in BPs IIRC?

    As far as additional info for NicoleG:
    The downside being that if they're partho, the likelyhood of them thriving decreases over time. They may hatch and do well for a while, but a lot of partho babies can start failing around the age of maturity (typically 2 years in BPs). This is why you may see breeders listing that the baby was partho in their info as well.
    Last edited by Armiyana; 08-10-2023 at 12:04 PM.

  11. The Following 5 Users Say Thank You to Armiyana For This Useful Post:

    Alicia (08-10-2023),Bogertophis (08-10-2023),Erie_herps (08-11-2023),Homebody (08-11-2023),nikkubus (08-11-2023)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1