Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,358

1 members and 2,357 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,107
Threads: 249,257
Posts: 2,573,006
Top Poster: JLC (31,651)
Welcome to our newest member, cheeseburger
Page 5 of 7 FirstFirst 1234567 LastLast
Results 41 to 50 of 67
  1. #41
    BPnet Veteran
    Join Date
    01-18-2018
    Posts
    649
    Thanks
    34
    Thanked 802 Times in 393 Posts

    Re: Best pythons or boas??

    Quote Originally Posted by AzJohn View Post
    Look at woma pythons
    I have a male woma. Can't imagine him being in anything less than a 4 x 2. Females will definitely at minimum need a 4 x 2, bigger for larger females. And they are active, not like a corn but nothing like a couch potato ball python. Mine explores, he uses all 5 of his hides (they are mainly there for stimulation) and would pick a random one to use every other day. Mine is almost never found curled up, stretched out and will use the space given.

    I just purchased a 40 gallon tank today for my growing corn. He is in there temporary until I see his full grown size so I can either upgrade or make it permanent. In your case, if you pick up a small adult colubrid, like a small corn or a gray banded king, that could work. Humidity is not a concern, and they don't seem too bothered being in a glass tank. Some boas and pythons can be shy eaters, like dumerils boa, where a glass tank may be at first intimidating to them.

    I also have a Children Python. I would recommend that for the 40g tank, but make sure to add plenty of climbing material. These snakes are a good size, but exploring is not so common as much as they just want to eat, a lot. The only time I see my Bender out of his hide perked on his drift wood is food, which is 99% of the time. Same spot. Every day. Not really paying attention to other things. The 1% is when he is in shed, he hides for days. So colubrids would be more entertaining to watch.

  2. The Following User Says Thank You to Cheesenugget For This Useful Post:

    vivi (04-12-2020)

  3. #42
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    21,014
    Thanks
    29,730
    Thanked 20,819 Times in 12,464 Posts
    I've only kept this one Spotted python, & never a Children's python, but some have talked about a challenge getting the tiny Children's python hatchlings to feed well,
    so that's one slight advantage (IMO) for the Spotted python...they're a little bit larger than Children's, so the hatchlings would generally be easier to get going, but either
    way you'd want to get one that's well-started with a feeding record for best results, & of course that goes for ANY kind of snake. The Spotted hatchlings are from 9 to
    13", whereas a Children's starts off between 8.5-10.5".
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  4. The Following User Says Thank You to Bogertophis For This Useful Post:

    vivi (04-12-2020)

  5. #43
    Registered User vivi's Avatar
    Join Date
    03-21-2020
    Location
    In a swamp.
    Posts
    294
    Thanks
    569
    Thanked 170 Times in 121 Posts

    Re: Best pythons or boas??

    Quote Originally Posted by Bogertophis View Post
    I've only kept this one Spotted python, & never a Children's python, but some have talked about a challenge getting the tiny Children's python hatchlings to feed well,
    so that's one slight advantage (IMO) for the Spotted python...they're a little bit larger than Children's, so the hatchlings would generally be easier to get going, but either
    way you'd want to get one that's well-started with a feeding record for best results, & of course that goes for ANY kind of snake. The Spotted hatchlings are from 9 to
    13", whereas a Children's starts off between 8.5-10.5".
    I'm willing to work with whatever I choose, and I know I can come to this forum if I need help.

    I'm bound to make a mistake at one point or another, but it's nice to be prepared.
    Last edited by vivi; 04-12-2020 at 12:32 PM.
    vivi

  6. The Following User Says Thank You to vivi For This Useful Post:

    Bogertophis (04-12-2020)

  7. #44
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    21,014
    Thanks
    29,730
    Thanked 20,819 Times in 12,464 Posts

    Re: Best pythons or boas??

    Quote Originally Posted by vivi View Post
    I'm willing to work with whatever I choose, and I know I can come to this forum if I need help.

    I'm bound to make a mistake at one point or another, but it's nice to be prepared.
    I know, & I get that...but newly-hatched snakes that don't naturally crave mouse pinks but rather lizards that "fit" are both a challenge & a risk, so make sure the breeder or source has them eating pinks, because if it's shipped to you (or even just because it's re-homed) many snakes go thru a set-back of not wanting to eat. As far as the size of these (either one) as hatchlings, they're as big or bigger than corn snakes. "Tiny" for those used to BPs, but not so tiny as they could be. (I've raised 7" glossy snakes too, so it actually COULD be worse, lol.) If BPs are "noodles", then these are "angel hair pasta".

    BTW, my spotted loves & uses a humid hide a LOT, so plan to use one. I do not otherwise regulate the humidity in her tank, & because of the warmth, it does dry out, but she sheds perfectly as long as I keep her humid hide damp. I'm sure this applies to Children's too. BTW, Children's pythons are so-named for the last name of the man who found them, it's not a "recommendation for ownership" though they do seem to make good pets anyway.
    Last edited by Bogertophis; 04-12-2020 at 12:46 PM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  8. The Following User Says Thank You to Bogertophis For This Useful Post:

    vivi (04-12-2020)

  9. #45
    Registered User vivi's Avatar
    Join Date
    03-21-2020
    Location
    In a swamp.
    Posts
    294
    Thanks
    569
    Thanked 170 Times in 121 Posts

    Re: Best pythons or boas??

    Quote Originally Posted by Bogertophis View Post
    I know, & I get that...but newly-hatched snakes that don't naturally crave mouse pinks but rather lizards that "fit" are both a challenge & a risk, so make sure the breeder or source has them eating pinks, because if it's shipped to you (or even just because it's re-homed) many snakes go thru a set-back of not wanting to eat. As far as the size of these (either one) as hatchlings, they're as big or bigger than corn snakes. "Tiny" for those used to BPs, but not so tiny as they could be. (I've raised 7" glossy snakes too, so it actually COULD be worse, lol.) If BPs are "noodles", then these are "angel hair pasta".

    BTW, my spotted loves & uses a humid hide a LOT, so plan to use one. I do not otherwise regulate the humidity in her tank, & because of the warmth, it does dry out, but she sheds perfectly as long as I keep her humid hide damp. I'm sure this applies to Children's too. BTW, Children's pythons are so-named for the last name of the man who found them, it's not a "recommendation for ownership" though they do seem to make good pets anyway.
    Right, i'll make sure they are well started on pinks. Thanks for the tip about the humid hide too!
    vivi

  10. #46
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    21,014
    Thanks
    29,730
    Thanked 20,819 Times in 12,464 Posts

    Re: Best pythons or boas??

    Quote Originally Posted by vivi View Post
    ...Thanks for the tip about the humid hide too!
    I use a rectangular plastic food container (mine's large since my snake is an adult, but you'll get by with a smaller one for a while) with an entry hole on top. Inside I use either orchid bark or sphagnum moss, well soaked & drained. You could also use other substrates that hold humidity instead (like Reptile Prime, etc.) in the humid hide.
    Last edited by Bogertophis; 04-12-2020 at 01:31 PM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  11. The Following 2 Users Say Thank You to Bogertophis For This Useful Post:

    Caitlin (04-12-2020),vivi (04-12-2020)

  12. #47
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    If you can find them, rubber boas would be great in a 40g. Added bonus with them is that they do not require supplemental heating and thrive a room conditions. They are difficult to track down however

    Another option I did not see (granted, I did power skim so I might have missed it) would be sand boas
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  13. The Following User Says Thank You to asplundii For This Useful Post:

    vivi (04-13-2020)

  14. #48
    Registered User vivi's Avatar
    Join Date
    03-21-2020
    Location
    In a swamp.
    Posts
    294
    Thanks
    569
    Thanked 170 Times in 121 Posts

    Re: Best pythons or boas??

    Quote Originally Posted by asplundii View Post
    If you can find them, rubber boas would be great in a 40g. Added bonus with them is that they do not require supplemental heating and thrive a room conditions. They are difficult to track down however

    Another option I did not see (granted, I did power skim so I might have missed it) would be sand boas
    I totally forgot about rubber boas.
    vivi

  15. #49
    BPnet Veteran
    Join Date
    01-18-2018
    Posts
    649
    Thanks
    34
    Thanked 802 Times in 393 Posts

    Re: Best pythons or boas??

    Quote Originally Posted by Bogertophis View Post
    I know, & I get that...but newly-hatched snakes that don't naturally crave mouse pinks but rather lizards that "fit" are both a challenge & a risk, so make sure the breeder or source has them eating pinks, because if it's shipped to you (or even just because it's re-homed) many snakes go thru a set-back of not wanting to eat. As far as the size of these (either one) as hatchlings, they're as big or bigger than corn snakes. "Tiny" for those used to BPs, but not so tiny as they could be. (I've raised 7" glossy snakes too, so it actually COULD be worse, lol.) If BPs are "noodles", then these are "angel hair pasta".

    BTW, my spotted loves & uses a humid hide a LOT, so plan to use one. I do not otherwise regulate the humidity in her tank, & because of the warmth, it does dry out, but she sheds perfectly as long as I keep her humid hide damp. I'm sure this applies to Children's too. BTW, Children's pythons are so-named for the last name of the man who found them, it's not a "recommendation for ownership" though they do seem to make good pets anyway.
    Never heard of a keeper of Children Pythons using humid hides (I get most of care keeping info from the Australian forums). I'm not against it at all though for any species to have a humid hide. That is what they would expect to find in the wild anyway, somewhere deep in the burrow where it is cooler and wet from the rain. However, my CP never touched it. I tried 3 times. He shed one piece on his own without issues. It is on average a 40-50% in my house here in FL, with AC on. I also tried providing a humid hide for the kings and corn. Only my Cali king used it once or twice. She prefers soaking in her bowl. Ironically, the times that I had stuck shed with any of my snakes are my ball python and dumerils boa, both are in tubs with 60-70% humidity. That too, happened like 2-3 times in the last 3 years I think.

    Fyi, CP's are more of a micro bat eater than lizard eaters. Bender's strong grip on my hand (and he was just holding on) helps me see that lol. They are known to hang on cave walls and grab micro bats as they fly. If they can get it, they do hunt rodent prey, birds and lizards.

    But yes, it is true baby snakes, especially those who have a more specialized diet, can be picky, like baby gray banded kings. That is why buying from a good breeder is important. You want the best start you can get with your new snake.

  16. The Following User Says Thank You to Cheesenugget For This Useful Post:

    vivi (04-13-2020)

  17. #50
    BPnet Veteran
    Join Date
    01-18-2018
    Posts
    649
    Thanks
    34
    Thanked 802 Times in 393 Posts

    Re: Best pythons or boas??

    Quote Originally Posted by asplundii View Post
    If you can find them, rubber boas would be great in a 40g. Added bonus with them is that they do not require supplemental heating and thrive a room conditions. They are difficult to track down however

    Another option I did not see (granted, I did power skim so I might have missed it) would be sand boas
    VMSHerp breeds rosy boas, which is more common than the rubber boa and falls within the same family. I had a sand boa from him and she was great. My corns came from him too. He also breeds transpecos, these are not commonly found but I heard nothing but great stuff (Boger knows more). But a 40gallon may be too small for a transpecos?

    His website is easy to use, if the snake did not transition to f/t (he tries to do that for all his hatchlings), he will list what it is eating so you are not caught unaware, and any questions or changes to the order can be made via email and he responds very quickly.

  18. The Following 2 Users Say Thank You to Cheesenugget For This Useful Post:

    Bogertophis (04-13-2020),vivi (04-13-2020)

Page 5 of 7 FirstFirst 1234567 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1