Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 796

0 members and 796 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,090
Threads: 249,230
Posts: 2,572,849
Top Poster: JLC (31,651)
Welcome to our newest member, GhostsnSnakes
Results 1 to 9 of 9
  1. #1
    Registered User PartySnake13's Avatar
    Join Date
    07-03-2019
    Posts
    98
    Thanks
    145
    Thanked 29 Times in 21 Posts

    Question Could banana/coral glow be considered a form of T+ albinism?

    It seems with other species people are quick to label reduced pigmentation morphs as a form of T+/caramel albinism. Many of these feature similar color schemes of adult bananas/ coral glows, featuring a yellow/ tan complexion with black freckling.

    I understand the presence & mechanism tyrosinase, but what exactly makes a T+ albino a T+ albino?




    Do bananas and coral glows technically meet the criteria of T+ albinism?


    Thank You.

  2. #2
    BPnet Veteran FollowTheSun's Avatar
    Join Date
    11-15-2018
    Posts
    674
    Thanks
    1,351
    Thanked 1,102 Times in 461 Posts
    I had wondered this myself on a less sophisticated level. But they have dark eyes, so maybe that rules them out? I'm interesting in hearing back from the experts
    2 BP's, one ratsnake, 2 dogs, 3 cats, 2 small caged birds, 7 chickens, and a toddler in a pear tree

  3. The Following User Says Thank You to FollowTheSun For This Useful Post:

    PartySnake13 (08-12-2019)

  4. #3
    BPnet Veteran the_rotten1's Avatar
    Join Date
    07-22-2016
    Location
    Bakersfield, CA
    Posts
    613
    Thanks
    3,352
    Thanked 645 Times in 319 Posts
    Images: 11
    There are caramel albino ball pythons. A lot of people just call them "caramel", but I'm pretty sure they're T+ if anything is. Banana is a co-dom gene. It's not even recessive. As far as I know albinism is a recessive gene whether it's T+ or T-.
    Last edited by the_rotten1; 08-12-2019 at 01:02 AM.
    ~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~

    Check me out on iHerp, Instagram, & visit my store!


  5. #4
    BPnet Veteran
    Join Date
    10-18-2018
    Location
    Brady, TX
    Posts
    224
    Thanks
    37
    Thanked 264 Times in 129 Posts
    Images: 21
    My female super Banana has eyes that are Ruby the way that a R-Locus dilute rat does. So there is some removal if pigment in the eyes from my own personal experience, if this helps either way.

    They do appear black at a glance but you can see they are blood ruby colored in the light.

  6. The Following 2 Users Say Thank You to pbenner For This Useful Post:

    FollowTheSun (08-12-2019),PartySnake13 (08-12-2019)

  7. #5
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Could banana/coral glow be considered a form of T+ albinism?

    There are no known T-negative albinos known in snakes. Even T-neg albino in the USA common rat snake is proven to not be T-neg.

  8. The Following User Says Thank You to paulh For This Useful Post:

    PartySnake13 (08-12-2019)

  9. #6
    Registered User PartySnake13's Avatar
    Join Date
    07-03-2019
    Posts
    98
    Thanks
    145
    Thanked 29 Times in 21 Posts

    Re: Could banana/coral glow be considered a form of T+ albinism?

    Quote Originally Posted by the_rotten1 View Post
    There are caramel albino ball pythons. A lot of people just call them "caramel", but I'm pretty sure they're T+ if anything is. Banana is a co-dom gene. It's not even recessive. As far as I know albinism is a recessive gene whether it's T+ or T-.
    Method of inheritance is not a qualifying factor for Albinism.

  10. #7
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Could banana/coral glow be considered a form of T+ albinism?

    The general definition among herpers for T-positive albinism is any mutant gene that is both recessive to the corresponding normal gene and seems to have some melanin but less than the normal amount. By this definition, coral glow/banana, lesser, pastel, and many other mutant genes are not T-positive albino genes.

    I think that the recessive to the corresponding normal gene criterion is irrelevant. As far as I can tell, its only benefit is to keep the T-positive albino group of genes from being unmanagably large.

    I generally ignore the T-positive/T-negative terminology. They are meaningless buzzwords. They make us think we know more about the biochemistry than we do, and they are totally artificial groupings. Besides, there are no proven T-negative albino snakes. The corn snake's "T-negative albino" mutant gene (AKA the amelanistic mutant gene) is now known to actually be OCA2-negative. As mating an amelanistic corn snake to a "T-negative albino" rat snake produces albino babies, the "T-negative albino" rat snake is also OCA2-negative instead of T-negative.

    For example, in boas Kahl albino and Sharp albino are both classed as T-negative albino because neither produces melanin. Sharon Moore caramel is classed as T-positive because it produces some melanin. However, nobody has done the work to determine whether any of them directly affects production of the tyrosinase enzyme; possibly none of them do. The Sharon Moore caramel gene and the Sharp albino gene can form a gene pair, which means they are different versions of the same gene and part of a natural grouping. On the other hand, the Sharp albino gene and the Kahl albino gene cannot form a gene pair. They are not different versions of the same gene and not part of a natural grouping.

  11. The Following 2 Users Say Thank You to paulh For This Useful Post:

    Alicia (08-13-2019),PartySnake13 (08-12-2019)

  12. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    To all intents and purposes, all the morphs we call T+ albino are actually some form or other of hypomelanism. This includes Banana/CG. The use of T+ in the hobby is just one more example of the bad information originally put out by early "big name" breeders who had/have a very limited understanding of genetics and proper terminology that has now become endemic and established as "fact"


    As Paul noted, there are no confirmed T- albino snakes but that does not mean they are not out there. Given that only one species had been interrogated at the genetic level, and based on the inferred relationship between corns and rats that Paul also noted, we really only have a n=1 sample size so it is possible that one of the amelanistic-phenotype morphs out there in the entire hobby will turn out to be a true T-. I suspect we would be most likely find this to be the case in Burms or retics where there are 3-4 known amelanistic-phenotype
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  13. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Alicia (08-13-2019),paulh (08-13-2019),pbenner (08-13-2019)

  14. #9
    BPnet Veteran
    Join Date
    10-18-2018
    Location
    Brady, TX
    Posts
    224
    Thanks
    37
    Thanked 264 Times in 129 Posts
    Images: 21

    Re: Could banana/coral glow be considered a form of T+ albinism?

    Quote Originally Posted by asplundii View Post
    To all intents and purposes, all the morphs we call T+ albino are actually some form or other of hypomelanism. This includes Banana/CG. The use of T+ in the hobby is just one more example of the bad information originally put out by early "big name" breeders who had/have a very limited understanding of genetics and proper terminology that has now become endemic and established as "fact"


    As Paul noted, there are no confirmed T- albino snakes but that does not mean they are not out there. Given that only one species had been interrogated at the genetic level, and based on the inferred relationship between corns and rats that Paul also noted, we really only have a n=1 sample size so it is possible that one of the amelanistic-phenotype morphs out there in the entire hobby will turn out to be a true T-. I suspect we would be most likely find this to be the case in Burms or retics where there are 3-4 known amelanistic-phenotype

    One of my absolute favorite posters on this site. Thank you thank you!

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1