» Site Navigation
1 members and 721 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,915
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
Re: Your #1 reptile

Flame the friendly dragon.
I’ve had her the longest, she is the best eater of any ball python (in history maybe, lol) and she is very friendly with me and even other people.
Plus she just looks amazing!
-
The Following 5 Users Say Thank You to Godzilla78 For This Useful Post:
Bogertophis (06-06-2019),dakski (06-06-2019),FollowTheSun (06-10-2019),Sonny1318 (06-07-2019),the_rotten1 (06-06-2019)
-
No pics on my computer here but...
From about the time I was 10 I had three "grail" species: GTP, BHP, and GBK. I was able to acquire two of those about a decade ago and picked up the third a few years back. Those three animals constitute my favourite
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Bodie (06-06-2019),Bogertophis (06-06-2019)
-
it's Rain, but don't tell the others.

RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following 10 Users Say Thank You to Ax01 For This Useful Post:
Bodie (06-06-2019),Bogertophis (06-06-2019),Craiga 01453 (06-06-2019),FollowTheSun (06-10-2019),Godzilla78 (06-06-2019),richardhind1972 (06-06-2019),SilentHill (06-06-2019),Sonny1318 (06-07-2019),the_rotten1 (06-06-2019),Timelugia (06-06-2019)
-
Re: Your #1 reptile
Hard to pick favorites but these guys are probably my “top” animals. My red pastel BCI and grande terre leachie gecko.


Sent from my iPhone using Tapatalk
-
The Following 6 Users Say Thank You to MarkL1561 For This Useful Post:
Bogertophis (06-06-2019),dakski (06-06-2019),FollowTheSun (06-10-2019),richardhind1972 (06-06-2019),Sonny1318 (06-07-2019),the_rotten1 (06-06-2019)
-
Re: Your #1 reptile
 Originally Posted by asplundii
No pics on my computer here but...
From about the time I was 10 I had three "grail" species: GTP, BHP, and GBK. I was able to acquire two of those about a decade ago and picked up the third a few years back. Those three animals constitute my favourite
I would love to see some pics if possible
0.1 Emerald Tree Boa (Northern)
0.1 Green Tree Python (Aru)
0.1 Pueblan Milk Snake
1.0 Mexican Black Kingsnake
1.0 Pied Het Lavender Albino Ball Python
1.0 Yellow Phase Eastern Hognose
-
-
Re: Your #1 reptile
 Originally Posted by Ax01
it's Rain, but don't tell the others.
 
what is she???
Sent from my SM-G950U using Tapatalk
Gargoyle Geckos: Gorey, Gremmie, Ouija, Gojira, Bacon Bit, Penny, Wednesday
Crested Geckos: Eggs, Triscuit, Creature & Waffles
Leopard Geckos: Rhubarb, Pepper and Clementine
Cal Kings: Bones & Violet
Corn snakes: A sh*tload
Trans-Pesos: 1.1 No names
BPs: Charlie (super pastel), Bodhi (pied), Finn (GHI Mojave), Dublin (fire bumblebee), Falkor(mystic potion), Letty (pewter), Jameson
BCI Boa: Specter (Fineline morph)
SnuSnu the cat, Corbin the pit bull, Juniper the mini aussie & Lily the setter mix
One little special needs bearded dragon P. Sherman
Black African House Snakes: 1.1 No names
Northern Pines: 1.1 No names
Four skinks, one of which is named Gator & Basil the mini-lop rabbit
'everything was beautiful and nothing hurt' - vonnegut.
www.facebook.com/SilentHillReptiles
-
-
Re: Your #1 reptile
 Originally Posted by SilentHill
what is she???
Sent from my SM-G950U using Tapatalk
Amazing!!!
I’m just a bill sitting on top of capital hill.
-
The Following User Says Thank You to Danger noodles For This Useful Post:
-
My favorite reptiles these days are my 2.1 Trans Pecos rat snakes (& sorry, no pics att either). And don't tell the other snakes...
Rudeness is the weak man's imitation of strength.
Eric Hoffer (1902 - 1983)
“The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi
-
The Following User Says Thank You to Bogertophis For This Useful Post:
FollowTheSun (06-10-2019)
-
Re: Your #1 reptile
I'm honestly not a huge fan of BPs (sorry everyone!). Having said that my number one snake would probably have to be my little juvenile BP. He was my fist pet snake and he's what started my obsession with the reptile world. He's a normal BP but he's beautiful and we have a pretty good bond.
-
The Following 2 Users Say Thank You to Toad37 For This Useful Post:
Bogertophis (06-06-2019),FollowTheSun (06-10-2019)
-
Re: Your #1 reptile
 Originally Posted by Bodie
I would love to see some pics if possible 
Ever since Photobucket went to Hades I kinda gave up posting pics. You can check out my IG though, I have some pics of them scattered in there: Snakes_n_Bakes
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|