» Site Navigation
0 members and 599 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,200
Top Poster: JLC (31,651)
|
-
Re: White Snakes
 Originally Posted by Turbo Serpent
Almost every super or ALS created from the BlkEL or BluEL has the ability to be "pure" white, but can also have pattern.
I will disagree with you here, there are some combos within each group that will never be pure white (like SuperPhantom or SuperVanilla).
 Originally Posted by Turbo Serpent
not sure what dictates the bleed through of the pattern in some but not others.
It is determined by the "strength" of the allele(s) you are working with, "stronger" alleles (e.g., more highly expressed mutation) will give reduce the likelihood of patterning/colouring arising. Lesser is stronger than Mojave is stronger than Phantom and so SuperLesser is less patterned/coloured than SuperMojave is less patterned/coloured than Phantom.
 Originally Posted by JodanOrNoDan
I am getting ready to do a bucket of white snakes picture. Waiting on one to come out of the egg. No two of the same combo. Will be interesting to see the opinions on the "whitest".
This will be interesting to see however I think you already know my caution that what these animals look like as hatchlings can be very different to how they look as adults. What people say is the "whitest" at 100g could look very different at 1000g.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Ronniex2 (07-25-2018),the_rotten1 (08-13-2018)
-
Re: White Snakes
Did someone say white snake? Could not resist.

Sent from my N9560 using Tapatalk
Last edited by Skyrivers; 07-24-2018 at 08:44 AM.
-
The Following 3 Users Say Thank You to Skyrivers For This Useful Post:
Lord Sorril (07-24-2018),Ronniex2 (07-25-2018),Sirus Uno (08-13-2018)
-
JodanOrNoDan, I wait in anticipation for those pics.
Ball Pythons
1.0 Pinstripe
1.0 Coral Glow Pastel
1.0 Ginger Enchi
1.0 Spectre
1.0 BlackPastel Yellowbelly
1.0 Albino
1.0 Fire
1.0 Enchi Mojave
1.0 Enchi
1.0 Calico
1.0 Leopard
0.1 Mojave Spider
0.1 Butter
0.2 Fire
0.1 Yellow Belly
0.2 Pastel
0.3 Normal
0.1 Bumblebee
0.1 Mystic
0.1 Enchi
0.1 Pinstripe 66% het Pied
0.1 Leopard
Other Pythons
1.0 Carpet Pythons
BOAS
1.1 Dumerils
2.2 Red Tail
Corns
1.2 Amel
-
-
Ball Pythons
1.0 Pinstripe
1.0 Coral Glow Pastel
1.0 Ginger Enchi
1.0 Spectre
1.0 BlackPastel Yellowbelly
1.0 Albino
1.0 Fire
1.0 Enchi Mojave
1.0 Enchi
1.0 Calico
1.0 Leopard
0.1 Mojave Spider
0.1 Butter
0.2 Fire
0.1 Yellow Belly
0.2 Pastel
0.3 Normal
0.1 Bumblebee
0.1 Mystic
0.1 Enchi
0.1 Pinstripe 66% het Pied
0.1 Leopard
Other Pythons
1.0 Carpet Pythons
BOAS
1.1 Dumerils
2.2 Red Tail
Corns
1.2 Amel
-
-
Re: White Snakes
 Originally Posted by asplundii
This will be interesting to see however I think you already know my caution that what these animals look like as hatchlings can be very different to how they look as adults. What people say is the "whitest" at 100g could look very different at 1000g.
Not only that, but it seems to be also influenced by the time of year and where they are in the shed cycle. Mojave complex BEL's hatch out light pink. I am not sure about YB or fire. I should have an Ivory baby this year. No babies in the fire complex though. That is next year.
In any case, I should have enough white animals of various ages and gene combos to have a little fun with. My original "operation" was designed to make RELs in as many combos as possible. Off of the top of my head, I think I have six clutches this year that will contain white snakes. All my other projects are being done to finance making the white snakes. LOL
Honest, I only need one more ...
-
The Following User Says Thank You to JodanOrNoDan For This Useful Post:
-
Re: White Snakes
 Originally Posted by asplundii
I will disagree with you here, there are some combos within each group that will never be pure white (like SuperPhantom or SuperVanilla).
That is why I prefaced it by saying almost every super or ALS.
 Originally Posted by asplundii
It is determined by the "strength" of the allele(s) you are working with, "stronger" alleles (e.g., more highly expressed mutation) will give reduce the likelihood of patterning/colouring arising. Lesser is stronger than Mojave is stronger than Phantom and so SuperLesser is less patterned/coloured than SuperMojave is less patterned/coloured than Phantom.
I understand, but I would love to see a genetic comparison between them, although they are allelic, maybe the strongest of them all would actually be the alleles that provide the non white supers. But again its all speculation until we could breakdown each morph to basic levels to look. This is one of the reasons why I love all of this, its very fascinating how it all works and how we can influence each aspect of it by introducing modifier genes for color and pattern.
1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown
-
The Following User Says Thank You to Turbo Serpent For This Useful Post:
-
Re: White Snakes
 Originally Posted by asplundii
I will disagree with you here, there are some combos within each group that will never be pure white (like SuperPhantom or SuperVanilla).
Super Fire also has yellow markings along the back.
-
-
Re: White Snakes
 Originally Posted by Skyrivers
Did someone say white snake? Could not resist.
Sent from my N9560 using Tapatalk
Great group , great songs and he had an amazing 'spoken' voice ..
Very 'well spoken' as I recall ..
I still recall 'that' video featuring his super-model u
Sent from my iPhone using Tapatalk Pro
-
-
Re: White Snakes
 Originally Posted by Zincubus
Great group , great songs and he had an amazing 'spoken' voice ..
Very 'well spoken' as I recall ..
I still recall 'that' video featuring his super-model girlfriend and a car ..
Sent from my iPhone using Tapatalk Pro
Sent from my iPhone using Tapatalk Pro
-
-
imma just leave these two here:
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following 5 Users Say Thank You to Ax01 For This Useful Post:
JodanOrNoDan (07-25-2018),Reptilius (07-31-2018),Ronniex2 (07-25-2018),the_rotten1 (08-13-2018),Turbo Serpent (07-24-2018)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|