Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 676

0 members and 676 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,201
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 2 of 2 FirstFirst 12
Results 11 to 19 of 19
  1. #11
    BPnet Lifer PghBall's Avatar
    Join Date
    04-20-2009
    Location
    Pleasant Hills, Pennsylvania
    Posts
    2,683
    Thanks
    996
    Thanked 1,191 Times in 952 Posts
    Images: 5

    Re: Surprise! I think it's Genetic Stripe

    I concur with some of the others. It is most likely the combination of Leopard, Mojave and Pinstripe that caused the stripe. However, stranger things have happened so it may not be a bad idea to pick up a Genetic Stripe of the opposite sex and breed them when they are of age
    - Greg

    Visit our Facebook page: https://www.facebook.com/412Balls/



    or our website: http://412balls.weebly.com/

  2. The Following User Says Thank You to PghBall For This Useful Post:

    rlditmars (04-10-2018)

  3. #12
    BPnet Veteran Alter-Echo's Avatar
    Join Date
    03-13-2018
    Location
    Albion NY
    Posts
    839
    Thanks
    621
    Thanked 780 Times in 453 Posts
    Can't help but wonder if it is some kind of genetic anomaly, maybe a one off thing like a paradox.

  4. The Following User Says Thank You to Alter-Echo For This Useful Post:

    rlditmars (04-10-2018)

  5. #13
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,382
    Thanks
    3,260
    Thanked 2,106 Times in 1,195 Posts

    Re: Surprise! I think it's Genetic Stripe

    Sometimes weird stripes happen when lots of genes combine.
    For example: Pastels and super pastels have zero striping, piebalds have no striping, but my super pastel piebald has a long unbroken stripe which I’m sure was not expected when the first killer pied was hatched!!!

    Hard to believe you would have a visual recessive gene just spring out of nowhere, maybe it is a new morph! Probably just a unique thing when lots of genes blended.

  6. The Following User Says Thank You to Godzilla78 For This Useful Post:

    rlditmars (04-10-2018)

  7. #14
    BPnet Lifer rlditmars's Avatar
    Join Date
    05-05-2012
    Posts
    2,964
    Thanks
    1,751
    Thanked 2,884 Times in 1,505 Posts

    Re: Surprise! I think it's Genetic Stripe

    Here is another picture. Like I said it may very well be just the four genes combined but it is a very prominent stripe and not much else for pattern. The color almost looks more in line with a Cinnamon Mojave combo, sort of pewter-ish, if that's a word? We'll see after a few sheds. Love all of the input just the same so keep it coming.


  8. #15
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,382
    Thanks
    3,260
    Thanked 2,106 Times in 1,195 Posts

    Re: Surprise! I think it's Genetic Stripe

    Definitely weird looking snake

  9. The Following User Says Thank You to Godzilla78 For This Useful Post:

    rlditmars (04-10-2018)

  10. #16
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts

    Re: Surprise! I think it's Genetic Stripe

    i called it; knew something was going on!:
    Quote Originally Posted by Ax01 View Post
    whatta variety and amazing quality to boot!! congrats!

    i look forward to seeing post-shed pix and progression pix of that Leo Pastel Mojo Pin. it almost looks like there's bands (ringers?) when the skin tone is lighter than darker. really cool stuff!
    nothing in the 4 known gene's really explains the obliterated side pattern. i got fingers and tails crossed for u that it is a G-Stripe for your OD Enchi Pastel het G-Stripe girl.



    Quote Originally Posted by Godzilla78 View Post
    Definitely weird looking snake
    i think it looks cool! a cool "mystery" snake!
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  11. The Following User Says Thank You to Ax01 For This Useful Post:

    rlditmars (04-10-2018)

  12. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    This animal is most assuredly not a GStripe and I say that as someone working with GStripes.

    Your animal is the four gene combo. There is a wide range of expression in these animals, yours just happens to fall toward the extreme end. The dorsal striping is consistent with what you get in Mojave Pin combos. It also appear that you might have some form of Harlequin-type gene coming from the Mojave Pastel parent
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  13. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Ax01 (04-11-2018),Godzilla78 (04-11-2018),rlditmars (04-11-2018)

  14. #18
    BPnet Lifer rlditmars's Avatar
    Join Date
    05-05-2012
    Posts
    2,964
    Thanks
    1,751
    Thanked 2,884 Times in 1,505 Posts

    Re: Surprise! I think it's Genetic Stripe

    Quote Originally Posted by asplundii View Post
    This animal is most assuredly not a GStripe and I say that as someone working with GStripes.

    Your animal is the four gene combo. There is a wide range of expression in these animals, yours just happens to fall toward the extreme end. The dorsal striping is consistent with what you get in Mojave Pin combos. It also appear that you might have some form of Harlequin-type gene coming from the Mojave Pastel parent
    Thanks Asplundii. I actually prefer to know it is just the 4 genes at play. I don't mind proving something out for myself, but I wouldn't want to put an animal out into the world that is an unknown quantity. It can be challenging enough to achieve a desired result when you know what you're working with. But with unknown variables at play it's like shooting in the dark.

    When you look at the pic of the Leopard Mojave Pinstripe, you wouldn't think adding a gene as basic as Pastel would change it to this extent. I guess I was really surprised that it obliterated the pattern and the color so much. She's powerful, but not very attractive IMO.

    What makes you think Harlequin-like on the Mojave Pastel? I am not really familiar with the gene or it's effect on pattern.

  15. The Following User Says Thank You to rlditmars For This Useful Post:

    Godzilla78 (04-11-2018)

  16. #19
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Surprise! I think it's Genetic Stripe

    Quote Originally Posted by rlditmars View Post
    When you look at the pic of the Leopard Mojave Pinstripe, you wouldn't think adding a gene as basic as Pastel would change it to this extent. I guess I was really surprised that it obliterated the pattern and the color so much.
    Just sort of how Pastel and Pin can interact, I have a Superblast that has very undefined laterals. Add in Leopard and you further shred it. Look at your LeoPastelPin and how uniform the laterals are on it, now wash that down with the colour drop effect and pattern condensation you get from Mojave and it is not hard to see how you get a full scrub effect.

    Also, give it a few sheds and the pattern may start to become more defined. That is something else I have seen in Pin combos, the patterning can take a few months before it becomes more obvious.


    Quote Originally Posted by rlditmars View Post
    She's powerful, but not very attractive IMO.
    The story of so many ball combos LOL


    Quote Originally Posted by rlditmars View Post
    What makes you think Harlequin-like on the Mojave Pastel? I am not really familiar with the gene or it's effect on pattern.
    Harlequin-type genes produce a genetically heritable tendency toward dorsal stripe. Your Mojave Pastel has a pretty strong dorsal stripe as do the Leopard Mojave Pastel and the LeoPastelPin you produced. Not an absolute guarantee of a Harly-type gene but it would not surprise me if further breedings from these animals produced more stripe-backed offspring
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  17. The Following User Says Thank You to asplundii For This Useful Post:

    rlditmars (04-12-2018)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1