» Site Navigation
0 members and 558 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,202
Top Poster: JLC (31,651)
|
-
Re: Surprise! I think it's Genetic Stripe
I concur with some of the others. It is most likely the combination of Leopard, Mojave and Pinstripe that caused the stripe. However, stranger things have happened so it may not be a bad idea to pick up a Genetic Stripe of the opposite sex and breed them when they are of age
-
The Following User Says Thank You to PghBall For This Useful Post:
-
Can't help but wonder if it is some kind of genetic anomaly, maybe a one off thing like a paradox.
-
The Following User Says Thank You to Alter-Echo For This Useful Post:
-
Re: Surprise! I think it's Genetic Stripe
Sometimes weird stripes happen when lots of genes combine.
For example: Pastels and super pastels have zero striping, piebalds have no striping, but my super pastel piebald has a long unbroken stripe which I’m sure was not expected when the first killer pied was hatched!!!

Hard to believe you would have a visual recessive gene just spring out of nowhere, maybe it is a new morph! Probably just a unique thing when lots of genes blended.
-
The Following User Says Thank You to Godzilla78 For This Useful Post:
-
Re: Surprise! I think it's Genetic Stripe
Here is another picture. Like I said it may very well be just the four genes combined but it is a very prominent stripe and not much else for pattern. The color almost looks more in line with a Cinnamon Mojave combo, sort of pewter-ish, if that's a word? We'll see after a few sheds. Love all of the input just the same so keep it coming.
-
-
Re: Surprise! I think it's Genetic Stripe
Definitely weird looking snake
-
The Following User Says Thank You to Godzilla78 For This Useful Post:
-
Re: Surprise! I think it's Genetic Stripe
i called it; knew something was going on!:
 Originally Posted by Ax01
whatta variety and amazing quality to boot!! congrats!
i look forward to seeing post-shed pix and progression pix of that Leo Pastel Mojo Pin. it almost looks like there's bands (ringers?) when the skin tone is lighter than darker. really cool stuff!
nothing in the 4 known gene's really explains the obliterated side pattern. i got fingers and tails crossed for u that it is a G-Stripe for your OD Enchi Pastel het G-Stripe girl.

 Originally Posted by Godzilla78
Definitely weird looking snake
i think it looks cool! a cool "mystery" snake!
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following User Says Thank You to Ax01 For This Useful Post:
-
This animal is most assuredly not a GStripe and I say that as someone working with GStripes.
Your animal is the four gene combo. There is a wide range of expression in these animals, yours just happens to fall toward the extreme end. The dorsal striping is consistent with what you get in Mojave Pin combos. It also appear that you might have some form of Harlequin-type gene coming from the Mojave Pastel parent
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
Ax01 (04-11-2018),Godzilla78 (04-11-2018),rlditmars (04-11-2018)
-
Re: Surprise! I think it's Genetic Stripe
 Originally Posted by asplundii
This animal is most assuredly not a GStripe and I say that as someone working with GStripes.
Your animal is the four gene combo. There is a wide range of expression in these animals, yours just happens to fall toward the extreme end. The dorsal striping is consistent with what you get in Mojave Pin combos. It also appear that you might have some form of Harlequin-type gene coming from the Mojave Pastel parent
Thanks Asplundii. I actually prefer to know it is just the 4 genes at play. I don't mind proving something out for myself, but I wouldn't want to put an animal out into the world that is an unknown quantity. It can be challenging enough to achieve a desired result when you know what you're working with. But with unknown variables at play it's like shooting in the dark.
When you look at the pic of the Leopard Mojave Pinstripe, you wouldn't think adding a gene as basic as Pastel would change it to this extent. I guess I was really surprised that it obliterated the pattern and the color so much. She's powerful, but not very attractive IMO.
What makes you think Harlequin-like on the Mojave Pastel? I am not really familiar with the gene or it's effect on pattern.
-
The Following User Says Thank You to rlditmars For This Useful Post:
-
Re: Surprise! I think it's Genetic Stripe
 Originally Posted by rlditmars
When you look at the pic of the Leopard Mojave Pinstripe, you wouldn't think adding a gene as basic as Pastel would change it to this extent. I guess I was really surprised that it obliterated the pattern and the color so much.
Just sort of how Pastel and Pin can interact, I have a Superblast that has very undefined laterals. Add in Leopard and you further shred it. Look at your LeoPastelPin and how uniform the laterals are on it, now wash that down with the colour drop effect and pattern condensation you get from Mojave and it is not hard to see how you get a full scrub effect.
Also, give it a few sheds and the pattern may start to become more defined. That is something else I have seen in Pin combos, the patterning can take a few months before it becomes more obvious.
 Originally Posted by rlditmars
She's powerful, but not very attractive IMO.
The story of so many ball combos LOL
 Originally Posted by rlditmars
What makes you think Harlequin-like on the Mojave Pastel? I am not really familiar with the gene or it's effect on pattern.
Harlequin-type genes produce a genetically heritable tendency toward dorsal stripe. Your Mojave Pastel has a pretty strong dorsal stripe as do the Leopard Mojave Pastel and the LeoPastelPin you produced. Not an absolute guarantee of a Harly-type gene but it would not surprise me if further breedings from these animals produced more stripe-backed offspring
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|