» Site Navigation
0 members and 648 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,915
Threads: 249,118
Posts: 2,572,196
Top Poster: JLC (31,651)
|
-
Human Chimerism...
I found this article really interesting, we often discuss what is a 'Chimera' and what affect it has on the ball python in question. Here's an example of human chimerism and this article explains how it affects her health and explains exactly what it is. I find it interesting that she has a split color through the length of her body, similar to some of the chimera ball pythons I've seen. Here's the article:
https://www.womenshealthmag.com/heal...259/chimerism/
It makes me wonder if a chimera ball python is always in pain as well?
Here's what we think is a possible chimera in ball pythons. I imagine it's impossible to breed this snake if it is indeed true chimerism, the DNA would be all messed up or if it does breed you would get one or the other genetic material, it's not possible to reproduce this in the offspring.

Last edited by cchardwick; 03-04-2018 at 09:30 AM.
-
The Following 3 Users Say Thank You to cchardwick For This Useful Post:
MD_Pythons (03-04-2018),Reinz (03-04-2018),tttaylorrr (03-04-2018)
-
Re: Human Chimerism...
here's another fascinating sorry about a woman who found out the children she gave birth to were genetically not her offspring, and the harrowing legal battle her family had to go through: http://abcnews.go.com/Primetime/shes...ory?id=2315693
i've never heard of the woman you posted, but my god she is beautiful!!! i'm so glad she's found a platform to talk about herself. that's awesome! i can only imagine what she deals with on a daily basis...a good friend had endometriosis; she had to have a hysterectomy at 16. ):
TBH, when it comes to Skittles, i'd like to think she has the best veterinary care available, and if she was in pain it would be known. also, the Skittles line has produced many other chimera babies (according to the breeder) so it will be interesting to learn more about Skittles if we ever can.
4.4 ball python
1.0 Albino ✮ 0.1 Coral Glow ✮ 0.1 Super Cinnamon paradox ✮ 1.0 Piebald ✮ 0.1 Pastel Enchi Leopard het Piebald ✮ 1.0 Coral Glow het Piebald ✮
1.0 corn snake
1.0 Hypo ✮
1.0 crested gecko
0.1 ???? ✮
0.1 cat
0.1 Maine Coon mix ✮
0.1 human ✌︎
-
-
That is whack, I had no idea what Chimerism was, and even more astounded that even some humans have this rare condition.
Thanks for the link
-
-
Very interesting CC, thanks!
The one thing I found that you can count on about Balls is that they are consistent about their inconsistentcy.
1.2 Coastal Carpet Pythons
Mack The Knife, 2013
Lizzy, 2010
Etta, 2013
1.1 Jungle Carpet Pythons
Esmarelda , 2014
Sundance, 2012
2.0 Common BI Boas, Punch, 2005; Butch, age?
0.1 Normal Ball Python, Elvira, 2001
0.1 Olive (Aussie) Python, Olivia, 2017
Please excuse the spelling in my posts. Auto-Correct is my worst enema.
-
-
Registered User
While I feel very sorry for the woman in the article, it seems that her issue is the autoimmune disease that she has, not being a chimera. In general most people who are chimeras don't even know unless there is something like DNA testing for child support that comes up in their life. Even that might not catch it depending on the patterning of their cells v. where the DNA sample is taken from.
Interestingly, chimerism does seem to have a genetic basis, and there's a pretty amusing article written about how it is actually very common in marmosets. For marmosets it's an evolutionary adaptation in order to motivate more adults to care for each offspring. Since snakes don't typically care for offspring, and especially not male snakes, chimerism probably isn't something that has been selected for in the wild. However, I'd guess that it would theoretically be possible to breed and artificially select for chimeras in order to create lines that were more prone to it.
-
The Following 2 Users Say Thank You to fieldfare For This Useful Post:
Godzilla78 (03-04-2018),MD_Pythons (03-04-2018)
-
Re: Human Chimerism...
 Originally Posted by fieldfare
While I feel very sorry for the woman in the article, it seems that her issue is the autoimmune disease that she has, not being a chimera. In general most people who are chimeras don't even know unless there is something like DNA testing for child support that comes up in their life. Even that might not catch it depending on the patterning of their cells v. where the DNA sample is taken from.
Interestingly, chimerism does seem to have a genetic basis, and there's a pretty amusing article written about how it is actually very common in marmosets. For marmosets it's an evolutionary adaptation in order to motivate more adults to care for each offspring. Since snakes don't typically care for offspring, and especially not male snakes, chimerism probably isn't something that has been selected for in the wild. However, I'd guess that it would theoretically be possible to breed and artificially select for chimeras in order to create lines that were more prone to it.
It seems you missed the part in the article that said her auto-immune disease is caused by her having 2 sets of DNA and 2 immune systems, so it is inherent in being a chimera to have this problem.
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to Godzilla78 For This Useful Post:
-
Re: Human Chimerism...
In the marmoset article, the definition seems different. The first woman completely absorbed her fraternal twin’s DNA.
Sent from my iPhone using Tapatalk
-
-
Registered User
Re: Human Chimerism...
The first article seemed a bit sensationalized (although it was still interesting) but it's actually the same thing happening in both. Chimeras are made up of cells that are genetically different, unlike most of us who have a single (mostly) consistent set of DNA throughout all of our cells. They still only have one set of DNA per cell. The lady in the first article's embryo fused early in development with what would have been her twin, but then developed normally aside from that, so some of her cells have one set of DNA and others have the other set of DNA. In marmosets, they just switch some cells while developing instead of fusing into one organism, but the end result is the same, just with both twins being born.
As for the auto immune issues, it makes sense that it could be a problem for chimeras but my point was that it is something that doesn't generally seem to be an major issue for them. The first article was kind of confusing with a lot of their terminology, especially the whole "two bloodstreams" part. If she has two different blood types then I am absolutely not surprised that she is having auto immune issues. Basically yeah it is something that could be a concern but I felt like it was over hyped and not very well explained.
-
The Following 2 Users Say Thank You to fieldfare For This Useful Post:
Godzilla78 (03-04-2018),Timelugia (03-04-2018)
-
Re: Human Chimerism...
A typical chimera starts as two fertilized egg cells. For birds and egg-laying snakes, the chimera must hatch from a double-yolked egg. I had a bullsnake that in three clutches dropped 1-3 eggs per clutch twice the size of the other eggs. These large eggs were probably double yolked. (I did not open them to see.) Such eggs hatched out one large but otherwise normal looking baby. And a Burmese python breeder buddy of mine often had one or two eggs in a clutch that contained twins. So double yolk eggs are not terribly uncommon.
Double yolk eggs also occur in chickens, too. http://www.abc.net.au/radionational/...lk-egg/7625330
Last edited by paulh; 03-04-2018 at 11:11 PM.
-
-
Re: Human Chimerism...
 Originally Posted by cchardwick
I imagine it's impossible to breed this snake if it is indeed true chimerism, the DNA would be all messed up or if it does breed you would get one or the other genetic material, it's not possible to reproduce this in the offspring.
It is completely possible for chimeras to breed. Nick Mutton has a chimeric carpet and it produced a perfectly fine clutch, all of which hatched out.
 Originally Posted by Godzilla78
It seems you missed the part in the article that said her auto-immune disease is caused by her having 2 sets of DNA and 2 immune systems, so it is inherent in being a chimera to have this problem.
False correlation. Just because this one woman, who is a chimera, developed an auto-immune disease does not mean that all chimeras will necessarily develop auto-immune disease. It is not an inherent condition of chimerism.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|