Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,095

2 members and 1,093 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

Lorri (51)

» Stats

Members: 75,945
Threads: 249,146
Posts: 2,572,379
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Page 1 of 2 12 LastLast
Results 1 to 10 of 15
  1. #1
    BPnet Veteran OTorresUSMC's Avatar
    Join Date
    06-08-2016
    Location
    Upstate NY
    Posts
    307
    Thanks
    129
    Thanked 96 Times in 72 Posts
    Images: 2

    Candy ball pythons

    I'm wondering how long do candy ball pythons hold their lavender and orange. From the few photos I've seen they turn a tan and like a light brown as adults, almost like adult ultramels does this happen within a few years or does it take longer?
    0.1 Woma Pinstripe "Gemma"
    0.1 Ultramel "Lyla"
    0.1 Bamboo Woma "Tara"
    0.1 Rio(Super Arroyo) "Wendy"
    1.0 Clown "Happy"
    1.0 Pastel Butter Ghost "Unser"
    1.0 KillerBee Yellow Belly "Half-Sack"

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Most Candy will attain their full colour by 12-18 months or so, though I have a friend who said one of his changed slowly until about 24 months
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    OTorresUSMC (02-26-2018)

  4. #3
    BPnet Veteran OTorresUSMC's Avatar
    Join Date
    06-08-2016
    Location
    Upstate NY
    Posts
    307
    Thanks
    129
    Thanked 96 Times in 72 Posts
    Images: 2

    Re: Candy ball pythons

    Quote Originally Posted by asplundii View Post
    Most Candy will attain their full colour by 12-18 months or so, though I have a friend who said one of his changed slowly until about 24 months
    I find it so strange how many BP morphs end up looking the same. If the photos I've seen are to be believed candy, toffee and ultramel all are very similar as adults. Kind of a shame when you think of how they start out as juveniles.
    0.1 Woma Pinstripe "Gemma"
    0.1 Ultramel "Lyla"
    0.1 Bamboo Woma "Tara"
    0.1 Rio(Super Arroyo) "Wendy"
    1.0 Clown "Happy"
    1.0 Pastel Butter Ghost "Unser"
    1.0 KillerBee Yellow Belly "Half-Sack"

  5. The Following User Says Thank You to OTorresUSMC For This Useful Post:

    C.Marie (03-01-2018)

  6. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Candy ball pythons

    Quote Originally Posted by OTorresUSMC View Post
    I find it so strange how many BP morphs end up looking the same. If the photos I've seen are to be believed candy, toffee and ultramel all are very similar as adults. Kind of a shame when you think of how they start out as juveniles.
    Well Candy and Toffee are the exact same mutation so it is no surprise that they look alike

    As far as Ultramel... They are a fair bit darker as adults that Candy/Toffee.

    If you like the lighter look of young Candy/Toffee then I would suggest picking up a CandIno or ToffIno, they stay really nice into adulthood
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    OTorresUSMC (02-27-2018)

  8. #5
    BPnet Veteran OTorresUSMC's Avatar
    Join Date
    06-08-2016
    Location
    Upstate NY
    Posts
    307
    Thanks
    129
    Thanked 96 Times in 72 Posts
    Images: 2

    Re: Candy ball pythons

    Quote Originally Posted by asplundii View Post
    Well Candy and Toffee are the exact same mutation so it is no surprise that they look alike

    As far as Ultramel... They are a fair bit darker as adults that Candy/Toffee.

    If you like the lighter look of young Candy/Toffee then I would suggest picking up a CandIno or ToffIno, they stay really nice into adulthood
    Didn't know toffee and candy were the same. Thanks for that. I finally picked up an ultramel which overall are my favorite. If money weren't an issue id have one of so many morphs lol. I envy breeders who have the ability to own hundreds of different snake.
    0.1 Woma Pinstripe "Gemma"
    0.1 Ultramel "Lyla"
    0.1 Bamboo Woma "Tara"
    0.1 Rio(Super Arroyo) "Wendy"
    1.0 Clown "Happy"
    1.0 Pastel Butter Ghost "Unser"
    1.0 KillerBee Yellow Belly "Half-Sack"

  9. The Following User Says Thank You to OTorresUSMC For This Useful Post:

    Sgt7212 (02-28-2018)

  10. #6
    Registered User Sgt7212's Avatar
    Join Date
    02-21-2018
    Location
    NJ
    Posts
    214
    Thanks
    306
    Thanked 186 Times in 111 Posts

    Re: Candy ball pythons

    Quote Originally Posted by OTorresUSMC View Post
    Didn't know toffee and candy were the same. Thanks for that. I finally picked up an ultramel which overall are my favorite. If money weren't an issue id have one of so many morphs lol. I envy breeders who have the ability to own hundreds of different snake.
    I don’t know much about morphs either. So many look alike to me, as well. But Semper Fi brother!


    Sent from my iPhone using Tapatalk
    Ball Pythons
    0.1 Spinner -“Cuddle Bug”
    0.1 Banana YB - “Chiquita Bonita”
    0.1 Super Lesser BEL - “Daenerys - Mother of Dragons”
    1.0 Pastel Highway - “Lt. Pete ‘Maverick’ Mitchell

    1.0 Super Citrus Bearded Dragon hopefully shipping mid-March, name pending.

  11. The Following User Says Thank You to Sgt7212 For This Useful Post:

    OTorresUSMC (02-28-2018)

  12. #7
    BPnet Royalty dakski's Avatar
    Join Date
    02-08-2014
    Location
    Connecticut
    Posts
    4,936
    Thanks
    8,347
    Thanked 10,063 Times in 3,992 Posts
    Images: 134

    Re: Candy ball pythons

    Quote Originally Posted by OTorresUSMC View Post
    Didn't know toffee and candy were the same. Thanks for that. I finally picked up an ultramel which overall are my favorite. If money weren't an issue id have one of so many morphs lol. I envy breeders who have the ability to own hundreds of different snake.
    Nice. Enjoy your ultramel! They are pretty! Post pictures if/when you can.

    I hear you on the many morphs; it's hard to have just one! Not sure I envy breeders though, that sounds like a lot of work, and poop, lot's of poop too!

    Seriously, enjoy your new addition.

    Thank you for your service!

    First male in my family in 3 generations not to serve (kidney problems - not proud of it). My grandfather in the army in WWII, my father and uncle in Vietnam (army and navy), my two cousins (Navy officer and Marine F-18 pilot).

    I know the sacrifices you make for the rest of us; sincerely, thank you (you too Sgt7212).
    Last edited by dakski; 02-28-2018 at 04:31 AM.

  13. The Following 2 Users Say Thank You to dakski For This Useful Post:

    OTorresUSMC (02-28-2018),Sgt7212 (02-28-2018)

  14. #8
    BPnet Veteran OTorresUSMC's Avatar
    Join Date
    06-08-2016
    Location
    Upstate NY
    Posts
    307
    Thanks
    129
    Thanked 96 Times in 72 Posts
    Images: 2

    Re: Candy ball pythons

    Appreciate the kind words dakski. And Semper Fi Sgt7212!! My ultramel girl is in shed right now but I'll get some pics up as soon as she's out. Many plans for her once she makes weight. May actually need to pick up an ultra male since I have a couple different genes I want to work in.
    0.1 Woma Pinstripe "Gemma"
    0.1 Ultramel "Lyla"
    0.1 Bamboo Woma "Tara"
    0.1 Rio(Super Arroyo) "Wendy"
    1.0 Clown "Happy"
    1.0 Pastel Butter Ghost "Unser"
    1.0 KillerBee Yellow Belly "Half-Sack"

  15. The Following User Says Thank You to OTorresUSMC For This Useful Post:

    dakski (02-28-2018)

  16. #9
    BPnet Veteran Aerries's Avatar
    Join Date
    02-16-2017
    Location
    Kissimmee Fl
    Posts
    951
    Thanks
    343
    Thanked 948 Times in 460 Posts
    Images: 16

    Re: Candy ball pythons

    Having a small collection is pretty time consuming as well, ehhh 20 animals in total but 6 BPs and my Boa still take time lol I’m wicked ocd with my husbandry and it drives me bonkers when they bulldoze everything lol

    3rd Battalion 7th Marines 2nd Brigade Combat Team, 1st Marine Expeditionary Force
    OIF 04-06 Ar Ramadi, Iraq

    OORAHH! Get some devils!


    Sent from my iPhone using Tapatalk

  17. The Following 3 Users Say Thank You to Aerries For This Useful Post:

    dakski (02-28-2018),Sgt7212 (02-28-2018),Virago (02-28-2018)

  18. #10
    Registered User Sgt7212's Avatar
    Join Date
    02-21-2018
    Location
    NJ
    Posts
    214
    Thanks
    306
    Thanked 186 Times in 111 Posts

    Re: Candy ball pythons

    Quote Originally Posted by Aerries View Post
    Having a small collection is pretty time consuming as well, ehhh 20 animals in total but 6 BPs and my Boa still take time lol I’m wicked ocd with my husbandry and it drives me bonkers when they bulldoze everything lol

    3rd Battalion 7th Marines 2nd Brigade Combat Team, 1st Marine Expeditionary Force
    OIF 04-06 Ar Ramadi, Iraq

    OORAHH! Get some devils!


    Sent from my iPhone using Tapatalk
    Semper Fi brother! Looks like the Marines have landed on BP.net 🦅⚓️


    Sent from my iPad using Tapatalk
    Ball Pythons
    0.1 Spinner -“Cuddle Bug”
    0.1 Banana YB - “Chiquita Bonita”
    0.1 Super Lesser BEL - “Daenerys - Mother of Dragons”
    1.0 Pastel Highway - “Lt. Pete ‘Maverick’ Mitchell

    1.0 Super Citrus Bearded Dragon hopefully shipping mid-March, name pending.

  19. The Following 3 Users Say Thank You to Sgt7212 For This Useful Post:

    dakski (02-28-2018),OTorresUSMC (02-28-2018),Virago (02-28-2018)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1