» Site Navigation
0 members and 1,104 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,701
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
Registered User
Black ball pythons
We are looking into adding another one to the collection in a few months. Me and my daughter both really like the bel’s or the ivory morph. It seems we are leaning towards almost a solid color snake. So we started to wonder are there any full black morphs out there, we did some internet searches but photoshop runs rampant on the internet. So we figured we’d ask are friends around here.
-
-
you'll find most solid-colored dark snakes are supers: super black pastels, super cinnamons, and the super mahogany are the solid-colored dark snakes. i have a super cinnamon myself and she's a beautiful baby. GHI is another morph that comes to mind which can produce some darker-colored combos.
if you haven't heard or WorldofBallPythons.com yet, i recommend typing things in and clicking around to learn some morphs. 
my super cinnamon paradox, Coffee Bean. she's bigger now than this photo and is starting to get this light speckling and a silvery undertone.
Last edited by tttaylorrr; 12-13-2017 at 06:22 PM.
Reason: info
4.4 ball python
1.0 Albino ✮ 0.1 Coral Glow ✮ 0.1 Super Cinnamon paradox ✮ 1.0 Piebald ✮ 0.1 Pastel Enchi Leopard het Piebald ✮ 1.0 Coral Glow het Piebald ✮
1.0 corn snake
1.0 Hypo ✮
1.0 crested gecko
0.1 ???? ✮
0.1 cat
0.1 Maine Coon mix ✮
0.1 human ✌︎
-
The Following 2 Users Say Thank You to tttaylorrr For This Useful Post:
Albert Clark (12-14-2017),Godzilla78 (12-13-2017)
-
Registered User
Re: Black ball pythons
Wow Yours is right up our alley. I showed my daughter and the longest awwwww you could imagine erupted.
-
The Following User Says Thank You to DandD For This Useful Post:
-
Registered User
Re: Black ball pythons
Super mohogany, super cinnamon and super black pastel are the closest i have seen to an all black snake.
If you wanted an all grey. Maybe look at the morph called silver bullet - super pastel super cinnamon. I would even venture to say a patternless mystic potion has a solid color, and maintains that to adulthood but lightens up.
Hope this helps 
Sent from my SM-G930V using Tapatalk
Edited to say, i just thought of another option. It isnt a totally black, snake but from what i have seen it maintains the black color really well as an adult. Check out GHI mojaves.
Last edited by Roux; 12-13-2017 at 08:11 PM.
-
-
I favor all black snakes and all white snakes, too! in fact, my next purchase is going to be a pair of Black Pastel Albinos, along with an extra Black Pastel female, so I can make Blizzards, Black Pastel Albinos and Albinos with one pairing and hopefully some Super Black Pastels with the other female. After much research it seems that Super Black Pastels are the best way to go for Black Ball Pythons. It's my understanding that Black Pastels hold their colors and the Supers don't brown out like others...
-
-
Registered User
Re: Black ball pythons
The amount of knowledge these forums kick out every time I ask a question is mind blowing. You guys are amazing
-
-
Check out ballroom pythons south, he works with super cinnamon and super black pastel regularly. He also has figured out how to create kink free ones with pretty good success. He usually has stuff on morph market and has a facebook page.
1.0 Albino Black Pastel Pinstripe BP "Menolo"
0.1 Albino Spider BP "Ginger"
0.1 Black Pastel Het. Albino "Jasmine"
1.0 Woma python "Stitch"
0.1 Woma python "Milo"
0.1 Woma python "Millie"
1.0 Blackhead Python
0.1 Blackhead Python
0.1 Blackhead Python
1.0 Black South African Boerboel "Midas"
0.1 Chocolate Lab "Coco"
-
-
As people have noted, SuperBlkPastel, SuperCinny and BlkPastel x Cinny (aka 8-Ball) will give you a solid dark snake but be aware that 1) they will become more brown as they age and 2) there is a known issue with kinking and duck-billing in these superforms so if you are trying to breed for them you may end up with some imperfect animals.
SuperMahogany (aka SUMA) produces a solid dark snake as well, but again, it tends to become brown rather than black as it ages. They also frequently have a hint of a gold dorsal stripe that appears on them.
JKR made a SUMA Cinny a couple years ago that was pretty dark however I have not seen any pics of it as it matured so no idea if it maintained that darkness.
Razor x BlkPastel and Huffman x BlkPastel make an interesting superform that is fairly solidly dark with a slate grey dorsal stripe. I have not seen any mature Huffman x BlkPastel but the adult BlackRazors I saw had stayed pretty dark and the stripe had darkened as well.
SuperGHI Mojave and SuperGHI BlkPastel (or Cinny) can also give you a dark animal with a dorsal stripe though occasionally you get some side pattern markings as well.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
I know you're looking for straight color, but ive always loved the "black pastels and the Chocolate pastels".
1.0 Normal BP
1.0 Mainland Reticulated
1.0 High lines Red Tail Boa
-
-
Re: Black ball pythons
 Originally Posted by asplundii
As people have noted, SuperBlkPastel, SuperCinny and BlkPastel x Cinny (aka 8-Ball) will give you a solid dark snake but be aware that 1) they will become more brown as they age and 2) there is a known issue with kinking and duck-billing in these superforms so if you are trying to breed for them you may end up with some imperfect animals.
I was actually talking with a local breeder friend of mine about this recently. He works with a lot of Black Pastels and he says that the key to avoiding kinking and duck billing with the supers is to incubate the eggs at lower temperatures for a longer period. He said he uses a completely separate incubator just for them and has had a huge success rate. He incubates his Super Black Pastel eggs at 85 - 86 degrees, which naturally causes them to take longer to incubate and he doesn't cut his eggs...
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|