» Site Navigation
0 members and 789 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,909
Threads: 249,108
Posts: 2,572,139
Top Poster: JLC (31,651)
|
-
Re: Spider x Spider results
Last edited by OhhWatALoser; 09-10-2017 at 10:43 AM.
-
The Following 3 Users Say Thank You to OhhWatALoser For This Useful Post:
Albert Clark (09-10-2017),Godzilla78 (09-10-2017),PitOnTheProwl (09-11-2017)
-
and apparently spider is dominant now...... 4:05 in.
Last edited by OhhWatALoser; 09-10-2017 at 11:47 AM.
-
-
Re: Spider x Spider results
Watched the video. IMO, just talking is a poor way to present genetics material. Adding pictures would be helpful. Markus Jayne has similar material in text on his web page. Adding pictures there would also be helpful but less helpful than when just using voice. See http://ballpython.ca/genetics-101/
For codominance vs. incomplete dominance, there is a technical difference in genetics texts, but the two are easy to confuse in practice. Actually, as we herpers use the term "codominance", it means something like "could be technically incomplete dominance or technically codominance, but I don't know which."
Kevin did not give any evidence to support the claim that spider is a dominant gene. So I will continue classifying it as not recessive, possibly (probably?) lethal when there are two spider genes in the gene pair.
-
The Following User Says Thank You to paulh For This Useful Post:
Albert Clark (09-11-2017)
-
Re: Spider x Spider results
 Originally Posted by paulh
Watched the video. IMO, just talking is a poor way to present genetics material. Adding pictures would be helpful. Markus Jayne has similar material in text on his web page. Adding pictures there would also be helpful but less helpful than when just using voice. See http://ballpython.ca/genetics-101/
For codominance vs. incomplete dominance, there is a technical difference in genetics texts, but the two are easy to confuse in practice. Actually, as we herpers use the term "codominance", it means something like "could be technically incomplete dominance or technically codominance, but I don't know which."
Kevin did not give any evidence to support the claim that spider is a dominant gene. So I will continue classifying it as not recessive, possibly (probably?) lethal when there are two spider genes in the gene pair.
I did ask him on Youtube and Facebook what he did to prove out a super spider, as he told everyone for years it didn't exist. Always welcome new info, but I still see the evidence as overwhelming on the lethal side. I mean explain the above animal, it's not the typical under developed white snake we see, it has color, just like toms.
I did bring the animal to the vet earlier, will report the results when I get em.
-
The Following 2 Users Say Thank You to OhhWatALoser For This Useful Post:
Albert Clark (09-11-2017),paulh (09-11-2017)
-
Actually a thought, if someone is that confident you can make a super spider, they could breed a bh spider to a bh spider, only 3 different phenotypes possible. No proving out necessary.
-
The Following User Says Thank You to OhhWatALoser For This Useful Post:
-
I guess no one told Kevin about the super pinstripes that BHB has been producing. It makes me wonder if someone will be able to get a super spider someday too.
~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~
Check me out on iHerp, Instagram, & visit my store!

-
-
Re: Spider x Spider results
 Originally Posted by OhhWatALoser
and apparently spider is dominant now...... 4:05 in.
So despite all of the documented evidence to the contrary, NERD still insists Spider is simple dominant?? SMH... The final part of that video title says volumes -- "a bunch of nonsense"
 Originally Posted by OhhWatALoser
Actually a thought, if someone is that confident you can make a super spider, they could breed a bh spider to a bh spider, only 3 different phenotypes possible. No proving out necessary.
This would be great, unfortunately there are very few people out there interested in breeding for anything other than making more combos
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Spider x Spider results
 Originally Posted by asplundii
This would be great, unfortunately there are very few people out there interested in breeding for anything other than making more combos
If someone wants to donate 1.1 bh spiders, I have no problem raising them and breeding them. Just a little too high of price range for an experiment that I'm already pretty confident of the results.
-
-
Re: Spider x Spider results
 Originally Posted by asplundii
So despite all of the documented evidence to the contrary, NERD still insists Spider is simple dominant?? SMH... The final part of that video title says volumes -- "a bunch of nonsense"
Yup and then my favorite is the people who claim they have done tons of breedings, yet offer nothing beyond that. Funny how we've been looking into this issue for years now, yet everyone on fb has all the answers already. This one I like because of the supposed number of breedings. Condescending statements and nothing to show for it.
Last edited by OhhWatALoser; 09-12-2017 at 11:45 AM.
-
-
Re: Spider x Spider results
 Originally Posted by OhhWatALoser
Yup and then my favorite is the people who claim they have done tons of breedings, yet offer nothing beyond that. Funny how we've been looking into this issue for years now, yet everyone on fb has all the answers already. This one I like because of the supposed number of breedings. Condescending statements and nothing to show for it.

(i've been lurking this thread since the beginning, pardon my sudden appearance)
but oh my goodness, these people! where's your proof? where's the photos and documentation? where's the darn snakes!?!? you'd think a clutch of a Spider x Spider pairing would be well documented by a breeder, let alone a thriving Super Spider! it's honestly amazing that this debate is still going on.
truly, SMH
4.4 ball python
1.0 Albino ✮ 0.1 Coral Glow ✮ 0.1 Super Cinnamon paradox ✮ 1.0 Piebald ✮ 0.1 Pastel Enchi Leopard het Piebald ✮ 1.0 Coral Glow het Piebald ✮
1.0 corn snake
1.0 Hypo ✮
1.0 crested gecko
0.1 ???? ✮
0.1 cat
0.1 Maine Coon mix ✮
0.1 human ✌︎
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|