Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 991

2 members and 989 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,098
Threads: 249,243
Posts: 2,572,935
Top Poster: JLC (31,651)
Welcome to our newest member, nightfallvt
Page 2 of 4 FirstFirst 1234 LastLast
Results 11 to 20 of 33
  1. #11
    BPnet Veteran BPGator's Avatar
    Join Date
    06-25-2016
    Posts
    766
    Thanks
    330
    Thanked 462 Times in 274 Posts
    Images: 15

    Re: Known Genetic Defects?

    So once again, is Spider x Woma lethal? And is Woma truly dominant or in the same category as Spider where the homozygous form is lethal?


    Sent from my iPhone using Tapatalk

  2. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Known Genetic Defects?

    Quote Originally Posted by JodanOrNoDan View Post
    I think statistically however we can say a viable (hobby terms) Super Spider, especially since we now know the mutation acts like a co-dom, has not and will not be produced.
    Oh, SuperSpiders have been produced... As dead white things. There are even a few pics floating around.


    Quote Originally Posted by BPGator View Post
    So once again, is Spider x Woma lethal?
    I have seen plenty of animals said to be SpiderWoma but I have never seen one of these animals actually breed out to be this. Most often they end up being just Spiders. And given that Woma also displays neuro issues my feeling is that, like Spider and any other neuro morph, the Spider x Woma is also lethal.


    Quote Originally Posted by BPGator View Post
    And is Woma truly dominant or in the same category as Spider where the homozygous form is lethal?
    I would say it is in the same category as SuperSpider. All the Woma x Woma clutches that I have been able to track have turned up nothing and the common denominator of neuro between the morphs it is not unreasonable to assume a similar fate for the superform
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    BPGator (07-28-2017),JodanOrNoDan (07-28-2017),OhhWatALoser (07-28-2017)

  4. #13
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Known Genetic Defects?

    Quote Originally Posted by asplundii View Post
    Oh, SuperSpiders have been produced... As dead white things. There are even a few pics floating around.




    I have seen plenty of animals said to be SpiderWoma but I have never seen one of these animals actually breed out to be this. Most often they end up being just Spiders. And given that Woma also displays neuro issues my feeling is that, like Spider and any other neuro morph, the Spider x Woma is also lethal.




    I would say it is in the same category as SuperSpider. All the Woma x Woma clutches that I have been able to track have turned up nothing and the common denominator of neuro between the morphs it is not unreasonable to assume a similar fate for the superform
    The keyword for the Super Spider was "viable". I have seen the pictures as well. It is why I avoid Spider x Spider crosses.

    It is my suspicion that woma, champagne etc will prove out to be co-dom just like the spider and some if not all turn out to be allelic with spider. It would be interesting to attempt to breed them to a blackhead and see what happens if it has not already been tried. I was talking to Mr. Davis about an adult blackhead to experiment with but it was just too much money to spend to just satisfy my curiosity.
    Honest, I only need one more ...

  5. The Following User Says Thank You to JodanOrNoDan For This Useful Post:

    BPGator (07-28-2017)

  6. #14
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Known Genetic Defects?

    Quote Originally Posted by asplundii View Post
    I have seen plenty of animals said to be SpiderWoma but I have never seen one of these animals actually breed out to be this. Most often they end up being just Spiders. And given that Woma also displays neuro issues my feeling is that, like Spider and any other neuro morph, the Spider x Woma is also lethal.

    I would say it is in the same category as SuperSpider. All the Woma x Woma clutches that I have been able to track have turned up nothing and the common denominator of neuro between the morphs it is not unreasonable to assume a similar fate for the superform
    I couldn't find a proven spider woma either. I also found woma x woma clutches extremely hard to find giving the confusion orginally with the hgw.

    I actually bought a woma female a couple years ago with the intent of just trying it out and seeing what happens. Didn't think about it at the time but I guess I won't be breeding my spider female to other spiders any more for data. Looks like the OD woma pin pastel i just got will be busy. Spider and woma female for data and also breeding him to my od pin fire female to make more possible super pins because I love long term projects lol.

  7. The Following 2 Users Say Thank You to OhhWatALoser For This Useful Post:

    BPGator (07-28-2017),JodanOrNoDan (07-28-2017)

  8. #15
    BPnet Veteran OTorresUSMC's Avatar
    Join Date
    06-08-2016
    Location
    Upstate NY
    Posts
    307
    Thanks
    129
    Thanked 96 Times in 72 Posts
    Images: 2

    Re: Known Genetic Defects?

    Quote Originally Posted by OhhWatALoser View Post
    I couldn't find a proven spider woma either. I also found woma x woma clutches extremely hard to find giving the confusion orginally with the hgw.

    I actually bought a woma female a couple years ago with the intent of just trying it out and seeing what happens. Didn't think about it at the time but I guess I won't be breeding my spider female to other spiders any more for data. Looks like the OD woma pin pastel i just got will be busy. Spider and woma female for data and also breeding him to my od pin fire female to make more possible super pins because I love long term projects lol.
    I thought pin didn't have a super form?

    Sent from my SM-G955U using Tapatalk
    0.1 Woma Pinstripe "Gemma"
    0.1 Ultramel "Lyla"
    0.1 Bamboo Woma "Tara"
    0.1 Rio(Super Arroyo) "Wendy"
    1.0 Clown "Happy"
    1.0 Pastel Butter Ghost "Unser"
    1.0 KillerBee Yellow Belly "Half-Sack"

  9. #16
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Known Genetic Defects?

    Quote Originally Posted by OTorresUSMC View Post
    I thought pin didn't have a super form?

    Sent from my SM-G955U using Tapatalk
    Every mutation has a super form. Since pin is dominant you would not be able to visually identify it. It would look no different whether it was a super or not a super. The full expression of the gene has already been reached with the hetero version. The only way to know if it is a super pin would be to breed it.
    Honest, I only need one more ...

  10. #17
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Known Genetic Defects?

    Double post
    Last edited by OhhWatALoser; 07-28-2017 at 03:11 PM.

  11. #18
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Known Genetic Defects?

    Quote Originally Posted by JodanOrNoDan View Post
    Every mutation has a super form. Since pin is dominant you would not be able to visually identify it. It would look no different whether it was a super or not a super. The full expression of the gene has already been reached with the hetero version. The only way to know if it is a super pin would be to breed it.
    Given I could only find 2 people admit to proving out a super pin, there still might be a subtle difference we just don't know what to look for yet. I currently have 3.4 pos super pins and they have pretty varying looks. Between proving some of then out and my orange dream ones I hope to make, I'm hoping to have a nice sample size to really look at them. I also try to keep in touch with others who have possible super pins to see if any prove out for them.

    Super pins had a long running rumor of being lethal also, once a few of these super pins prove out and publicly shown, we can bury that rumor for good

    Most recent pic I have
    Last edited by OhhWatALoser; 07-28-2017 at 03:17 PM.

  12. #19
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Known Genetic Defects?

    Quote Originally Posted by OhhWatALoser View Post
    Given I could only find 2 people admit to proving out a super pin, there still might be a subtle difference we just don't know what to look for yet. I currently have 3.4 pos super pins and they have pretty varying looks. Between proving some of them out and my orange dream ones I hope to make, I'm hoping to have a nice sample size to really look at them. I also try to keep in touch with others who have possible super pins to see if any prove out for them.
    I work a lot with pin. So far I have not produced any Super Pins at least none that I have held back. Next season I am doing a few more pin to pin crosses. I will keep you updated on anything looking unusual.
    Honest, I only need one more ...

  13. #20
    BPnet Veteran robert7107's Avatar
    Join Date
    06-16-2016
    Location
    shingle springs ca
    Posts
    568
    Thanks
    126
    Thanked 169 Times in 94 Posts

    Re: Known Genetic Defects?

    This is the YouTube video of Kevin from nerd talking about spider to spider .




    Time 1:03
    https://youtu.be/-fhnR5YdGdI

    Sent from my Pixel XL using Tapatalk

Page 2 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1