» Site Navigation
0 members and 622 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,909
Threads: 249,108
Posts: 2,572,139
Top Poster: JLC (31,651)
|
-
Re: Known Genetic Defects?
So once again, is Spider x Woma lethal? And is Woma truly dominant or in the same category as Spider where the homozygous form is lethal?
Sent from my iPhone using Tapatalk
-
-
Re: Known Genetic Defects?
 Originally Posted by JodanOrNoDan
I think statistically however we can say a viable (hobby terms) Super Spider, especially since we now know the mutation acts like a co-dom, has not and will not be produced.
Oh, SuperSpiders have been produced... As dead white things. There are even a few pics floating around.
 Originally Posted by BPGator
So once again, is Spider x Woma lethal?
I have seen plenty of animals said to be SpiderWoma but I have never seen one of these animals actually breed out to be this. Most often they end up being just Spiders. And given that Woma also displays neuro issues my feeling is that, like Spider and any other neuro morph, the Spider x Woma is also lethal.
 Originally Posted by BPGator
And is Woma truly dominant or in the same category as Spider where the homozygous form is lethal?
I would say it is in the same category as SuperSpider. All the Woma x Woma clutches that I have been able to track have turned up nothing and the common denominator of neuro between the morphs it is not unreasonable to assume a similar fate for the superform
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
BPGator (07-28-2017),JodanOrNoDan (07-28-2017),OhhWatALoser (07-28-2017)
-
Re: Known Genetic Defects?
 Originally Posted by asplundii
Oh, SuperSpiders have been produced... As dead white things. There are even a few pics floating around.
I have seen plenty of animals said to be SpiderWoma but I have never seen one of these animals actually breed out to be this. Most often they end up being just Spiders. And given that Woma also displays neuro issues my feeling is that, like Spider and any other neuro morph, the Spider x Woma is also lethal.
I would say it is in the same category as SuperSpider. All the Woma x Woma clutches that I have been able to track have turned up nothing and the common denominator of neuro between the morphs it is not unreasonable to assume a similar fate for the superform
The keyword for the Super Spider was "viable". I have seen the pictures as well. It is why I avoid Spider x Spider crosses.
It is my suspicion that woma, champagne etc will prove out to be co-dom just like the spider and some if not all turn out to be allelic with spider. It would be interesting to attempt to breed them to a blackhead and see what happens if it has not already been tried. I was talking to Mr. Davis about an adult blackhead to experiment with but it was just too much money to spend to just satisfy my curiosity.
Honest, I only need one more ...
-
The Following User Says Thank You to JodanOrNoDan For This Useful Post:
-
Re: Known Genetic Defects?
 Originally Posted by asplundii
I have seen plenty of animals said to be SpiderWoma but I have never seen one of these animals actually breed out to be this. Most often they end up being just Spiders. And given that Woma also displays neuro issues my feeling is that, like Spider and any other neuro morph, the Spider x Woma is also lethal.
I would say it is in the same category as SuperSpider. All the Woma x Woma clutches that I have been able to track have turned up nothing and the common denominator of neuro between the morphs it is not unreasonable to assume a similar fate for the superform
I couldn't find a proven spider woma either. I also found woma x woma clutches extremely hard to find giving the confusion orginally with the hgw.
I actually bought a woma female a couple years ago with the intent of just trying it out and seeing what happens. Didn't think about it at the time but I guess I won't be breeding my spider female to other spiders any more for data. Looks like the OD woma pin pastel i just got will be busy. Spider and woma female for data and also breeding him to my od pin fire female to make more possible super pins because I love long term projects lol.
-
The Following 2 Users Say Thank You to OhhWatALoser For This Useful Post:
BPGator (07-28-2017),JodanOrNoDan (07-28-2017)
-
Re: Known Genetic Defects?
 Originally Posted by OhhWatALoser
I couldn't find a proven spider woma either. I also found woma x woma clutches extremely hard to find giving the confusion orginally with the hgw.
I actually bought a woma female a couple years ago with the intent of just trying it out and seeing what happens. Didn't think about it at the time but I guess I won't be breeding my spider female to other spiders any more for data. Looks like the OD woma pin pastel i just got will be busy. Spider and woma female for data and also breeding him to my od pin fire female to make more possible super pins because I love long term projects lol.
I thought pin didn't have a super form?
Sent from my SM-G955U using Tapatalk
0.1 Woma Pinstripe "Gemma"
0.1 Ultramel "Lyla"
0.1 Bamboo Woma "Tara"
0.1 Rio(Super Arroyo) "Wendy"
1.0 Clown "Happy"
1.0 Pastel Butter Ghost "Unser"
1.0 KillerBee Yellow Belly "Half-Sack"
-
-
Re: Known Genetic Defects?
 Originally Posted by OTorresUSMC
I thought pin didn't have a super form?
Sent from my SM-G955U using Tapatalk
Every mutation has a super form. Since pin is dominant you would not be able to visually identify it. It would look no different whether it was a super or not a super. The full expression of the gene has already been reached with the hetero version. The only way to know if it is a super pin would be to breed it.
Honest, I only need one more ...
-
-
Re: Known Genetic Defects?
Last edited by OhhWatALoser; 07-28-2017 at 03:11 PM.
-
-
Re: Known Genetic Defects?
 Originally Posted by JodanOrNoDan
Every mutation has a super form. Since pin is dominant you would not be able to visually identify it. It would look no different whether it was a super or not a super. The full expression of the gene has already been reached with the hetero version. The only way to know if it is a super pin would be to breed it.
Given I could only find 2 people admit to proving out a super pin, there still might be a subtle difference we just don't know what to look for yet. I currently have 3.4 pos super pins and they have pretty varying looks. Between proving some of then out and my orange dream ones I hope to make, I'm hoping to have a nice sample size to really look at them. I also try to keep in touch with others who have possible super pins to see if any prove out for them.
Super pins had a long running rumor of being lethal also, once a few of these super pins prove out and publicly shown, we can bury that rumor for good
Most recent pic I have
Last edited by OhhWatALoser; 07-28-2017 at 03:17 PM.
-
-
Re: Known Genetic Defects?
 Originally Posted by OhhWatALoser
Given I could only find 2 people admit to proving out a super pin, there still might be a subtle difference we just don't know what to look for yet. I currently have 3.4 pos super pins and they have pretty varying looks. Between proving some of them out and my orange dream ones I hope to make, I'm hoping to have a nice sample size to really look at them. I also try to keep in touch with others who have possible super pins to see if any prove out for them.
I work a lot with pin. So far I have not produced any Super Pins at least none that I have held back. Next season I am doing a few more pin to pin crosses. I will keep you updated on anything looking unusual.
Honest, I only need one more ...
-
-
Re: Known Genetic Defects?
This is the YouTube video of Kevin from nerd talking about spider to spider .
Time 1:03
https://youtu.be/-fhnR5YdGdI
Sent from my Pixel XL using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|