Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,353

0 members and 2,353 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

» Stats

Members: 76,107
Threads: 249,255
Posts: 2,572,990
Top Poster: JLC (31,651)
Welcome to our newest member, cheeseburger
Page 3 of 3 FirstFirst 123
Results 21 to 25 of 25
  1. #21
    Registered User
    Join Date
    09-25-2013
    Posts
    3
    Thanks
    0
    Thanked 9 Times in 2 Posts
    Images: 1
    Quote Originally Posted by Zincubus View Post
    Slight tangent but I've got a pair of brilliant white , Luicistic Texas Rat snakes but the female has red eyes and the male seems to have blue eyes ... What's going on there I wonder ?

    That one is easy enough: your female is both leucistic and amelanistic. Often called "pink eyed leucistic."

    Quote Originally Posted by greco View Post
    This is crazy! I definitely see the ivory. Maybe it's the lighting but the eyes look darker than ivory eyes, which can look black but are a very dark blue with dark red pupils. Those eyes look more like super fire eyes to me. But the orange pattern on white looks like albino!
    Quote Originally Posted by greco View Post
    Any chance the dam could be fire too?
    The eyes are very dark with red pupils. I do not believe the dam could be fire.

    Quote Originally Posted by Zincubus View Post
    For my money, what you have is a case where both parents were carrying the Albino allele and your animal is most likely a chimera. The Albino sections are AlbinoYB (which also accounts for the yellow head) and the Ivory portions are just that: Ivory. And the dark eyes are derived from them originating from Ivory lineage cells


    With regard to the siblings, was there Fire in any of them and/or were any of them WT? Just want to see if we can pin down who exactly dad was.
    This is close to what we believe as well, but it's obviously less likely that both parents are hidden hets rather than just one or the other. I'm not sure if there were fire siblings or not, but it shouldn't matter if there were. She was bred to both males and siblings could have been sired by either.

    Quote Originally Posted by Ax01 View Post
    wow it's beautiful! ISOWANTTHAT! Paradox/Chimera's are awesome! u guys at GR aer producing some unique animals:

    I thought of that highway too when I saw this hatchling, so I went back and checked the records but they aren't directly related (different sires/dams).

  2. #22
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Ivory/Albino Paradox? Chimera? What is this thing?

    Quote Originally Posted by nicolerc View Post
    This is close to what we believe as well, but it's obviously less likely that both parents are hidden hets rather than just one or the other.
    While it may be less likely that both parents were unknown hets it is even more unlikely that you would see a case of a mosaic with regionalized alternating monoallelism happening so that you get patches that are entirely Albino/YB and patches that are entirely non-Albino/Ivory but no patches that are non-Albino/YB or Albino/Ivory


    Quote Originally Posted by nicolerc View Post
    I'm not sure if there were fire siblings or not, but it shouldn't matter if there were. She was bred to both males and siblings could have been sired by either.
    Superficially, yes it does not matter. But, if in all the other siblings there are no Fire or WT then the statistical odds of this one animal being from a different sire are much reduced. And if you can pin down the likely father then you can consider proving it out as het Albino at some later date.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #23
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Ivory/Albino Paradox? Chimera? What is this thing?

    Quote Originally Posted by asplundii View Post
    While it may be less likely that both parents were unknown hets it is even more unlikely that you would see a case of a mosaic with regionalized alternating monoallelism happening so that you get patches that are entirely Albino/YB and patches that are entirely non-Albino/Ivory but no patches that are non-Albino/YB or Albino/Ivory
    For those of us that are big word challenged (like me), are you saying that it is more likely the both parents were het albino since there appears to be a lack of pattern consistent with a normal patterned animal?
    Honest, I only need one more ...

  4. #24
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Ivory/Albino Paradox? Chimera? What is this thing?

    Quote Originally Posted by JodanOrNoDan View Post
    For those of us that are big word challenged (like me), are you saying that it is more likely the both parents were het albino since there appears to be a lack of pattern consistent with a normal patterned animal?
    LOL... Sorry, I lapsed into jargon there didn't I? Let me try again.

    In a mosaic-type paradox, you have a situation where one of the alleles in the pair "drops out" so you see the effect on the allele that is left (this is called monoallelism). So, if we imagine a simple case of an animal that is WT het Albino, if the WT allele "drops out" all that is left is the Albino allele and the tissue patches in the "drop out" area will look Albino.

    Now, if we posit that this animal here is a mosaic and not a chimera then genetically the animal would have to be a Yellowbelly het Albino and we would be seeing the Ivory phenotype from "drop out" of the WT allele at the YB locus and the Albino phenotype from "drop out" of the WT allele at the Albino locus. But you would not see these two separate and independent "drop out" events happening in an alternating pattern giving perfect, discreet regions of each. Instead, we would a more chaotic distribution of "drop outs" where some regions would be phenotypically YB, some areas would be AlbinoYB, some areas would be Ivory, and some areas would be Albino Ivory. We do not see the first and last of those phenotypes in this animal.

    Flipside, if we posit that the animal here is a chimera then what you have is a case where there was a fusion event between an AlbinoYB zygote and an Ivory zygote which very easily gives rise to the two discreet and delineated phenotype regions that we are seeing.


    Does that make more sense than my earlier gibberish?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    AbsoluteApril (07-26-2017),JodanOrNoDan (07-26-2017),Rcbeanxx (08-16-2017)

  6. #25
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Ivory/Albino Paradox? Chimera? What is this thing?

    Quote Originally Posted by asplundii View Post
    Does that make more sense than my earlier gibberish?
    LOL. yeah. you did a pretty good job, thank you. It is sometimes very hard to describe things in layman's terms so I appreciate the effort. I have the same problem when trying to describe engineering concepts.
    Honest, I only need one more ...

Page 3 of 3 FirstFirst 123

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1