» Site Navigation
0 members and 968 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
|
-
-
The Following 2 Users Say Thank You to Tila For This Useful Post:
spellbound04 (07-03-2017),the_rotten1 (07-04-2017)
-
Registered User
Re: Possible impact of pattern variation?
I have no idea but he's stunning
1.0 Normal
Normal doesn't mean boring! 😊
-
The Following User Says Thank You to spellbound04 For This Useful Post:
-
Fused alien heads are not uncommon in BlkPastel
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
PitOnTheProwl (07-03-2017)
-
I am aware that fused alien heads are common. My question is what influence the more fused pattern style may have on a morph combination that already does that sort of thing, such as a black pastel mojave. I have read that only certain aspects of morphs are directly heritable and the rest appears due to chance but I was hoping someone with a similar appearing snake might have bred theirs and would be willing to share the outcome. I enjoy using the morph calculator but it is limited. It would be cool if they added a feature where you could choose things like "reduced pattern x" or "high expression x" to try out in pairings.
-
-
Tgatcccgtcactataggatcgtaactaccatgtccgtttaattggagtactg. By the way, asplundii, I complemented your footnote. Forgive me, it was pretty base.
-
-
It somewhat resembles my cinnamon line and the 'smeared' patterning seemed to breed true in cinnamon offspring but I have not produced a combo to compare the patterns yet. I would expect in some snakes the patterns will breed true and in others it will not. Like all genetic traits, you would still need to breed it out to prove whether it will or will not show true.
Most morphs are basically just a genetic pattern that breeds true after all.
Theresa Baker
No Legs and More
Florida, USA
"Stop being a wimpy monkey,; bare some teeth, steal some food and fling poo with the alphas. "
-
The Following User Says Thank You to wolfy-hound For This Useful Post:
-
 Originally Posted by Tila
I am aware that fused alien heads are common. My question is what influence the more fused pattern style may have on a morph combination that already does that sort of thing, such as a black pastel mojave. I have read that only certain aspects of morphs are directly heritable and the rest appears due to chance but I was hoping someone with a similar appearing snake might have bred theirs and would be willing to share the outcome. I enjoy using the morph calculator but it is limited. It would be cool if they added a feature where you could choose things like "reduced pattern x" or "high expression x" to try out in pairings.
While it all comes down to genetics of some sort, it is a matter of do the right random combination of genes that, in combination, affect the outcome to give you the phenotype you are looking for. With SuperBlk complex animals, the het BluEl genes and the Pied allele seem to push toward a greater occurrence of fused alien heads. Flip side, fused alien heads does not necessarily mean that there is a het BluEL or a Pied allele in the mix, it could just be some random other gene(s) interacting with the SuperBlk gene. Now, you could certainly selectively breed to maintain that phenotype, enriching for the presence of the other random gene(s), but once outside of your collection there is no guarantee the phenotype will be perpetuated because others might not maintain the level of selective breeding you would have.
 Originally Posted by Tila
Tgatcccgtcactataggatcgtaactaccatgtccgtttaattggagtactg. By the way, asplundii, I complemented your footnote. Forgive me, it was pretty base.
Not sure what you were trying to say… I translated your sequence (in all three frames) and I did not come up with any coherent “words”. And a BLAST was equally uninformative… 
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Possible impact of pattern variation?
-
-
Re: Possible impact of pattern variation?
 Originally Posted by Tila
Thanks for the info. That was really helpful,
that's what I was wondering about.e
No worries
 Originally Posted by Tila
I thought the letters stood for the 4 nitrogenous bases found in DNA, guanine, adenine, thymine and cytosine. I thought you represented a sequence of nucleobases (probably non-coding) so I mirrored them (t pairs with a, g pairs with c) hence the science-themed puns of "complement" and "base." Epic science joke fail, in short. 
Okay, I see now. Yes, my sig is a nucleotide sequence but it is not a naturally occurring one (at least not so far). I assumed you had translated the sequence and then had replied in the same manner... I totally missed that you had simply generated the complementary strand LOL. So fail on my end as well
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|