» Site Navigation
1 members and 849 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,107
Posts: 2,572,120
Top Poster: JLC (31,651)
|
-
Registered User
Patternless morphs?
Hello.
I am really hoping someone can recommend some plain looking morphs similar to the patternless or champagne pinstripe morphs (ideally I would have loved a patternless, but I can't seem to find them anywhere even in America, let alone the UK...) Thanks!
-
-
Bels and super cinnamons are also patternless snakes. It just depends on what colour you want!
Having a quick look on world of ball pythons,there are a few super cinny combos that are different colour and still patternless.
Snakes:
~Ball Pythons: 1.0 Spider (Corkii) --- 1.0 Mojave (Meeko) --- 1.0 Bumblebelly (Pringle) --- 0.1 Normal (Fraggles) --- 0.1 Lesser Enchi (Khaleesi) --- 1.0 Pied (Piper)
~Cornsnakes: 0.1 Tessera.het Amel Motley (Twiglet) --- 1.0 Amel (Wotsit)
~Hognose: 0.0.1 Normal.66%hetAlbino (Waffle)
~Boa: 0.1 Normal (Medusa)
~Spotted Python 0.1 (Unnamed)
~Bredlis Python 0.1 (Unnamed)
~Burmese Python: 0.1 Granite (Skittles)
Lizards:
~Crested Geckos: 1.0 Buckskin Dalmatian (Rex) --- 0.1 Orange Dalmatian (Apollo) --- 1.1 Harlequin (Cosmos / Nova) --- 1.0 Extreme Harlequin (Dino) --- 1.1 Halloween Partial Pin (Pumpkin/Unnamed) --- 1.0 Red and Cream partial pin (unnamed)
~Leopard Gecko: 1.0 Hypo (Dave)
~Bearded Dragon: 0.1 Red Leatherback.hetTrans
~Ackie Monitor: 0.0.1 (Unnamed)
~Jewled Lecarta 1.0 (Wizard)
Others:
Tortoise, Dog, Tarantulas, Parrot
-
The Following User Says Thank You to LightningPython For This Useful Post:
-
Re: Patternless morphs?
Lesser Champagnes have very little pattern and some color besides white.
-
The Following User Says Thank You to rlditmars For This Useful Post:
-
I have a PurplePassion Pinstripe that is pretty much patternless (has a faint dorsal stripe) and a PurplePassion that has very little pattern.
GStripe BlkPastel and GStripe Cinny seem to be pretty consistently low pattern
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
There is also pinstripe mystic potions, various champagne combos such as champagne cinnamon, etc. and a few of the amalgamations that NERD makes.
Last edited by Seven-Thirty; 01-17-2017 at 11:06 AM.
-
The Following User Says Thank You to Seven-Thirty For This Useful Post:
-
BPnet Veteran
Re: Patternless morphs?
 Originally Posted by asplundii
I have a PurplePassion Pinstripe that is pretty much patternless (has a faint dorsal stripe) and a PurplePassion that has very little pattern.
GStripe BlkPastel and GStripe Cinny seem to be pretty consistently low pattern
I also have a virtually patternless passion. Gorgeous snake and breeding her with my black head red gene at the moment. I really want some of her babies.
-
The Following User Says Thank You to yardy For This Useful Post:
-
Figured I would throw a pic up of the PassionPin
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 4 Users Say Thank You to asplundii For This Useful Post:
AlexisFitzy (01-19-2017),Marzipan (01-18-2017),yardy (01-25-2017),Zincubus (01-18-2017)
-
Registered User
Re: Patternless morphs?
 Originally Posted by asplundii
Figured I would throw a pic up of the PassionPin

Holy moly, that is one stunning morph!
-
-
Re: Patternless morphs?
 Originally Posted by asplundii
Figured I would throw a pic up of the PassionPin

That's so beautiful!
Sent from my iPad using Tapatalk
-
-
 Originally Posted by Marzipan
Holy moly, that is one stunning morph! 
 Originally Posted by Zincubus
That's so beautiful!
I actually prefer his sister -- PurplePassion Enchi Pin female. Pretty sure this girl is a world’s first.

Last edited by asplundii; 01-19-2017 at 09:40 AM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|