» Site Navigation
2 members and 595 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,117
Posts: 2,572,189
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Re: Freaking out!! Fire to Normal makes white snake?!!
 Originally Posted by asplundii
In the link Hooblah posted there is a post by me that has a second link which explains the "null" phenomenon. The "mechanism" is really very simple; a second copy of the gene (in this case the WT copy) is simply missing, by way of any of a number of means.
Here. Save you the time having to hunt it down:
http://www.reptileradio.net/ball-pyt...tml#post769750
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
h00blah (05-19-2013),Redemption Reptiles (05-17-2013)
-
Re: Freaking out!! Fire to Normal makes white snake?!!
Hmmm very interesting to see! Mom really does look normal.. I'll be following this one!
Sent from my SPH-D710 using Tapatalk 2
1.0 Spider "Charlie"
1.1 Normal "Precious" "Chumley"
0.1 Pastel "Sweet Dee"
1.1 Mojave "Stewie" "Little Bit"
0.1 Lesser "Sally"
1.0 Pied "Jack"
1.0 Nile Monitor "Superman"
0.1 Bearded Dragons "Snookie"
0.0.1 Sulcuta Tortoise "Kenny Powers"
1.0 Chocolate lab "Dante"
1.0 Now snake obsessed boyfriend
-
The Following User Says Thank You to jbean7916 For This Useful Post:
-
Mom looks a LOT like my dinker female. I might have to put my fire male with her next year!
Angela
-
The Following User Says Thank You to aldebono For This Useful Post:
-
Registered User
Re: Freaking out!! Fire to Normal makes white snake?!!
I would love to see the pic of it when it's out of the egg! Do you have a pic of the dame completely exposed (head to tail)?
-
The Following 2 Users Say Thank You to lingmeister For This Useful Post:
-
Can the null phenomenon happen with just the male genes contributing? Most parthenogenesis involves the female genes.
Look at Mom's head: that's a lot of blushing. I bet she's carrying a fire gene allele.
Anyway, you should definitely repeat this pairing. It's for SCIENCE.
- - - Updated - - -
ps. Congratulations on winning the random white snake lottery!
Last edited by loonunit; 05-17-2013 at 01:17 PM.
-Jackie Monk
-
The Following 2 Users Say Thank You to loonunit For This Useful Post:
-
Yea, she must carry something compatible with fire. Isn't the lemonback the same allele? I am sure there are others and mom sure had a surprise up her sleeve. Can't wait to see these little ones out!
God Bless http://www.iherp.com/elbee
_____
1.0 Pastel, 1.0 Albino, 1.0 Piebald, 1.0 Pastel Butter Spotnose
0.1 Het pied, 0.1 Pewter, 0.1 Super Pastel, 0.1 Champagne, 0.1 BEL, 0.1 Pastel Leopard
1.1 Thayeri Kingsnake
1.0 Hog Island Boa
0.2 Western Hognose (normal and purple line albino)
-
The Following User Says Thank You to elbee For This Useful Post:
-
Re: Freaking out!! Fire to Normal makes white snake?!!
I can't wait to see what happens when you eventually breed that white baby.
Sent from microwave via Tapatalk ll
Balls:
*0.1 Mojave *0.1 Pinstripe *0.1 Bumblebee *1.0 Super pastel butter *1.0 Mojave orange ghost *0.3 100% het orange ghosts *0.1 Pastel 50% het orange ghost *1.1 PE Lemonback fires *1.0 Fire *0.1 Pastel *1.0 Albino *0.1 Spider 100% het albino
Other critters:
*1.0 Anery motley corn *G. rosea tarantula *G. pulchripes *P. metallica *0.0.2 A. versicolor *C. cyaneopubescens *A. geniculata *B. smithi *B. boehmei *Nhandu chromatus *H. maculata *C. marshalli *1.0 Australian shepherd mix
-
The Following User Says Thank You to Coleslaw007 For This Useful Post:
-
hopefully the white ones a male... back to mommy he can go! Plus you can breed it to other females then and see what surprises come out.
0.1 Albino
0.2 Classic
0.1 Het. Red Axanthic
0.1 Mojave h. Ghost
0.1 Pastel
0.1 Spider h. Ghost
1.0 Black Pastel
1.0 Blue Eye Leucistic h. Ghost
1.0 Lesser
1.0 Pastel h. Ghost
0.1 Morelia bredli
0.0.1 Varanus acanthurus (Silly)
0.1 Brachypelma auratum
0.1 Scottisch Fold (Tipsy)
0.1 Abyssinian (Prim)
http://www.facebook.com/AAExoten
-
The Following User Says Thank You to eatgoodfood For This Useful Post:
-
Re: Freaking out!! Fire to Normal makes white snake?!!
 Originally Posted by loonunit
Can the null phenomenon happen with just the male genes contributing? Most parthenogenesis involves the female genes.
"Null" phenomenon and parthenogenesis are wholly unrelated and have nothing to do with one another.
 Originally Posted by elbee
Yea, she must carry something compatible with fire.
No necessarily
 Originally Posted by elbee
Isn't the lemonback the same allele?
Yes, it is. But it is not at all a subtle morph that could ever be mistaken for a WT
 Originally Posted by elbee
I am sure there are others
Obviously there are: Disco and Vanilla and RDR DesertLemon and Sulphur and Flame Hypo and Lucifer and Eraserhead and... But here is the thing, there is an absolute trend line these morphs follow and the more normal they look the less they react with Fire. So if that female is some type of "cryptic" BlkEL allele then she would not produce a white snake when bred to a Fire.
 Originally Posted by Coleslaw007
I can't wait to see what happens when you eventually breed that white baby.
Fires and normals
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
-
Very interesting. Can't wait to see how things progress with this.
-
The Following User Says Thank You to TessadasExotics For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|