Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 515

0 members and 515 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,117
Posts: 2,572,189
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Page 1 of 3 123 LastLast
Results 1 to 10 of 25
  1. #1
    Registered User
    Join Date
    02-09-2013
    Posts
    2,385
    Thanks
    200
    Thanked 581 Times in 459 Posts

    Missing morphs 1: Enchi + any 8 ball gene, Albino Fire

    Hi there


    I did some research on different morphs and on gene complexes, basically i searched for morphs on WOBP that prove that two genes are NOT part of the same gene complex. Its an ongoing project, for many morphs and morph combinations this is quite easy. And sometimes you hit brick walls that make you wonder. Anyway i wont go into much detail, its just that for two combinations i need your help, im not drawing conclusions yet, just keeping my eyes open for some missing morphs. a while ago i had 3 morphs on my list, pinstripe clown was also missing, but has now been produced.


    the first morph im looking for: A super enchi, that in addition also has cinnamon or het red axanthic or black pastel in it. OR a morph that contains just regular enchi, and two genes from the gene complex (cinnamon + het red axanthic + black pastel). like an enchi onyx or something, or enchi super black pastel. Basically any BP with 3 genes from this selection: enchi, cinnamon, het red axanthic, black pastel.

    the second morph im looking for: Albino, with any gene from the black eye lucy complex added. Basically albino fire, or albino disco, or albino sulfur, or albino vanilla.

    im just checking if anyone has seen something like that or has produced it, i couldnt find them. Thanks in advance for your help. (Next step, if these morphs stay absent, would be to look for people that might have done the appropriate pairings to produce them).

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    If BlkEL and Albino were in the same complex then Fire x Albino should generate a visual morph and I have seen Fire het Albinos available so that would kind of prove that those two morphs are not allelic.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #3
    Registered User
    Join Date
    02-09-2013
    Posts
    2,385
    Thanks
    200
    Thanked 581 Times in 459 Posts

    Re: Missing morphs 1: Enchi + any 8 ball gene, Albino Fire

    Quote Originally Posted by asplundii View Post
    If BlkEL and Albino were in the same complex then Fire x Albino should generate a visual morph and I have seen Fire het Albinos available so that would kind of prove that those two morphs are not allelic.
    albino is recessive, so, no, doesnt prove anything. a super fire het albino would prove something, an albino fire would prove something. Breedings of albino to fire het albino, or fire het albino to fire het albino, could prove or disprove it, but for now im just looking for the morph.

  4. #4
    BPnet Royalty Mike41793's Avatar
    Join Date
    12-15-2011
    Posts
    16,925
    Thanks
    6,667
    Thanked 7,981 Times in 5,584 Posts

    Missing morphs 1: Enchi + any 8 ball gene, Albino Fire

    Super cinny would probably wash out the enchi gene. So would a cinny, black pastel, enchi.

    Super fire would washout the albino gene.

    I assure you, they are compatible and aren't in the same complex. They just aren't really morphs that go well together so not many people are trying to produce them. Cinny enchis have been made and are pretty plain looking imo. Im sure there are other breeders out there who have the same opinion/taste as me.
    Last edited by Mike41793; 03-29-2013 at 10:01 AM.
    1.0 normal bp

  5. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Missing morphs 1: Enchi + any 8 ball gene, Albino Fire

    Quote Originally Posted by Kurtilein View Post
    albino is recessive, so, no, doesnt prove anything. a super fire het albino would prove something, an albino fire would prove something. Breedings of albino to fire het albino, or fire het albino to fire het albino, could prove or disprove it, but for now im just looking for the morph.
    Yeah, actually is does prove something. With a firm grasp of what recessive and incomplete-dominant mean we know that a recessive allele could not partially repress an incomplete-dominant allele at a given locus and so there would indeed be a visual phenotype if you were dealing with an allelic pair. And the fact that the Fire het Albino looks like nothing more than a Fire tells you that the WT allele at the Fire locus is partially repressing the Fire allele at said locus and theretofore, Albino and Fire cannot be allelic.


    And Mike, I disagree with you slightly on the SuperFire Albino. SuperFire would not fully mask the Albino presence; the eyes would be red.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    HypoLyf (03-29-2013),irishanaconda (03-29-2013),snakesRkewl (03-29-2013)

  7. #6
    BPnet Veteran Herpenthusiast3's Avatar
    Join Date
    01-25-2013
    Location
    Northern California
    Posts
    440
    Thanks
    145
    Thanked 157 Times in 126 Posts

    Missing morphs 1: Enchi + any 8 ball gene, Albino Fire

    This thread is blowing my simple human mind! One day ill be able to keep up with the genetic jargon of BP's used by you all!!! Until then<---- once again humbled by the realization that I will always be learning.

  8. #7
    BPnet Royalty Mike41793's Avatar
    Join Date
    12-15-2011
    Posts
    16,925
    Thanks
    6,667
    Thanked 7,981 Times in 5,584 Posts

    Missing morphs 1: Enchi + any 8 ball gene, Albino Fire

    Quote Originally Posted by asplundii View Post
    And Mike, I disagree with you slightly on the SuperFire Albino. SuperFire would not fully mask the Albino presence; the eyes would be red.
    You know what I meant :p

    But yea. It'd look similar to a cherry bomb id imagine.
    1.0 normal bp

  9. #8
    BPnet Veteran Raven01's Avatar
    Join Date
    01-29-2013
    Location
    Peterborough, ON
    Posts
    854
    Thanks
    254
    Thanked 332 Times in 233 Posts
    Images: 2

    Re: Missing morphs 1: Enchi + any 8 ball gene, Albino Fire

    In order to get the red eyes you would need two copies of the same gene since the albino is recessive.
    I may be off as my 1st coffee isn't into me yet but, as I understood it there was discussion about Super Fire+Heterzygous Albino. Which would show very little if anything other than Super Fire traits.
    It would be interesting to see the results of allelic recessive gene combination if any are discovered.
    The likelihood of even an allelic recessive not being completely washed out by a co-dom or dominant gene the same way "normal" genes completely cover (or very nearly so) them is so slim it would be inconclusive at best trying to prove this out without using the homozygous form of any recessive.

  10. #9
    BPnet Senior Member Royal Hijinx's Avatar
    Join Date
    12-01-2011
    Location
    San Diego, CA
    Posts
    3,842
    Thanks
    1,120
    Thanked 1,989 Times in 1,155 Posts
    OP, I swear you are intentionally confusing.

    Are you trying to ask for proof that Enchi and any Cinny/BP complex are not allelic? Or the BlkEL and Albino are not allelic?

    OR

    Do you just want to see if someone has made a Super Enchi Cinny or a Fire Albino?

  11. The Following 2 Users Say Thank You to Royal Hijinx For This Useful Post:

    Domepiece (04-09-2013),irishanaconda (03-29-2013)

  12. #10
    Registered User
    Join Date
    02-09-2013
    Posts
    2,385
    Thanks
    200
    Thanked 581 Times in 459 Posts

    Re: Missing morphs 1: Enchi + any 8 ball gene, Albino Fire

    allelic or not, what if two morphs just sit on the same chromosome pair? But otherwise they dont affect each other, nothing really visible, its just that you hit a wall when you try to combine them, because you can only have two of these genes maximum. One gene per chromosome, chromosomes are in the same pair, so a snake can only have two of these, one from mom one from dad... you get the idea. If two true recessives would have that issue, and you try to combine them, the first thing you notice is that when breeding double hets to double hets, the odd gods just seem to hate you very very much and you just fail to hit the double recessive visual.

    the complete genome of the ball python only has 18 chromosomes. and how many base morphs do we have?

    we know 6 gene complexes so far. i just for fun tried to find morphs that prove that all these complexes are, in fact, seperate. Basically going at the problem backwards: no assumptions, i just see how far i can go simply by proving that two genes are NOT on the same chromosome and fully compatible.

    a sample of my findings so far, just for the known gene complexes, and yes i use my own abbreviations and terms:

    Code:
    known 6 complexes set: 
    BEL, albino, pied, Cin/BlkPa/RedAx, Ivory/Superstripe, Disco/F/Sulfur/V
    
    BEL albino:       albino lesser, albino mojave, albino super mojave , ?                 <<<<done  
    BEL pied:             lesser pied, enchi lesser pied, mystic pied, mojave pied          <<<<<done
    BEL Cin/BlkPa/RedAx: super cin mojave, lesser super cin, lesser red ax, red ax mystic   <<<<<done
    BEL Ivory/Superstripe:  ivory mojo phantom, butter superstripe, phantom SS, mojo SS, ...<<<<<done
    BEL Disco/F/Sulfur/V:  sulfur mystic mojave, sulfur super mojave, super mojave vanilla  <<<<done
    albino pied:               clear visible albino pied                                    <<<<<done
    albino Cin/BlkPa/RedAx:  albino super cinny, albino super black pastel                  <<<<<done
    albino Ivory/Superstripe:  albino (+pastel) yellow belly, albino ivory           <<not much
    albino Disco/F/Sulfur/V:                 !!!!!!!   !!!completely missing!!!
    pied Cin/BlkPa/RedAx:  super cinnamon pied, lots of cinnamon pied, super blkpa pied.  <<<<<done
    pied Ivory/Superstripe: pumpkin pied, ivory pied,          <<not much
    pied Disco/F/Sulfur/V:  fire pied                                           < just 1 morph
    Cin/BlkPa/RedAx Ivory/Superstripe:  cinnamon superstripe, black pastel superstripe   <<not much
    Cin/BlkPa/RedAx Disco/F/Sulfur/V:  mercury ball (fire supercinny), ..?                  < just 1 morph
    Ivory/Superstripe Disco/F/Sulfur/V:  fire ivory, ivory vanilla, fire pastel superstripe, 
                                   lots of vanilla superstripe                                 <<<<<done

    so, im almost done proving that the 6 known BP gene complexes do sit on different chromosome pairs by compiling morphs that contain 3 or 4 copies of just the right genes. i have already proven that the 6 known gene complexes sit on at least 5 different chromosomes. (ive also already proven that clown does not sit on any of the chromosomes inhabited by the 6 known gene complexes, i found all morphs required to do so. with enchi i ran into an issue.)

    you know that feeling when you are 90% done with something, and then hit a wall. about visible or not.... just an albino fire, should be visible, at least if you have a clutch containing albino and albino fire. i mean, someone bred an albino pied blue eye lucy and proved it out, people go to crazy lengths for a world first, or so you would think. low-hanging fruit for a world first morph i think.

    or, the enchi issue.... enchi red axanthic, super enchi cinnamon, super enchi het red axanthic, super enchi black pastel, enchi cinnamon het red axanthic, enchi black pastel het red axanthic. <----- From what we know, only super cinnamon, super black pastel, and cinnamon black pastel destroy the pattern and lead to patternless snakes. All the other enchi combos i listed could, as far as we know, have a pattern, at least they dont contain something that would definitively ruin the pattern. All of these would be world firsts that noone seems to have done yet, all are either a super + one more gene, or a 3-gene combo.
    Last edited by Pythonfriend; 03-29-2013 at 12:44 PM.

Page 1 of 3 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1