» Site Navigation
0 members and 555 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,117
Posts: 2,572,189
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Registered User
This confuses me 
does the gene act like a recessive and a co-dom ?
-
-
Re: Het Platty?
The way I understand it, it's like an invisible codom that only shows when combined with the BEL genes. Idk if that made any sense, I understand it lol.
Balls:
*0.1 Mojave *0.1 Pinstripe *0.1 Bumblebee *1.0 Super pastel butter *1.0 Mojave orange ghost *0.3 100% het orange ghosts *0.1 Pastel 50% het orange ghost *1.1 PE Lemonback fires *1.0 Fire *0.1 Pastel *1.0 Albino *0.1 Spider 100% het albino
Other critters:
*1.0 Anery motley corn *G. rosea tarantula *G. pulchripes *P. metallica *0.0.2 A. versicolor *C. cyaneopubescens *A. geniculata *B. smithi *B. boehmei *Nhandu chromatus *H. maculata *C. marshalli *1.0 Australian shepherd mix
-
-
Re: Het Platty?
 Originally Posted by DG76
does the gene act like a recessive and a co-dom ?
 Originally Posted by Coleslaw007
The way I understand it, it's like an invisible codom that only shows when combined with the BEL genes. Idk if that made any sense, I understand it lol.
The "Daddy" gene is simply the weakest expression hetBluEL allele in the clade. It is not totally "invisible" because people (RDR included) are now beginning to be able to pick out animals based on cryptic traits that are proving to be "Daddy."
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Het Platty?
Is there a super daddy? Surely if it is in fact a part of the BEL group then it would have a super of some sort.
-
-
Re: Het Platty?
Yeah, at first i believed it would be something like special or het russo, like in my earlier post, but now with more pictures and the great comparison shots its clear that het daddy is weaker than any other gene in the BEL complex.
 Originally Posted by Coleslaw007
The way I understand it, it's like an invisible codom that only shows when combined with the BEL genes. Idk if that made any sense, I understand it lol.
this is correct.
Is there a super daddy? Surely if it is in fact a part of the BEL group then it would have a super of some sort.
there really should be one, and it should not be hard to produce. If you breed a lesser het daddy to lesser het daddy, you get: 25% super lesser (BEL), 50% lesser het daddy, and 25% super het daddy. In such a pairing you are guaranteed to only get 2-gene animals, and whatever offspring doesnt look like a lesser or blue eye lucy MUST be a super het daddy. (and for the minimal chance that super daddy is lethal/absent, which i dont believe since the gene is sooooo subtle, you could prove that out with the same pairing: you should then only get super lessers and lesser het daddy, with 33%/66% odds, and never get anything else).
Maybe there are so few combos with this gene on WOBP, because its too subtle to see with other genes, like for example: spider het daddy or pastel het daddy are soo subtle that the breeders have trouble distingushing it in clutches, and the guys over at worldofballpython have trouble to accept the combo because its too subtle, lost in the noise of natural variation. To get a new morph added you need to CONVINCE the people at WOBP.
-
-
Re: Het Platty?
 Originally Posted by interloc
Is there a super daddy? Surely if it is in fact a part of the BEL group then it would have a super of some sort.
 Originally Posted by Kurtilein
there really should be one, and it should not be hard to produce. If you breed a lesser het daddy to lesser het daddy, you get: 25% super lesser (BEL), 50% lesser het daddy, and 25% super het daddy. In such a pairing you are guaranteed to only get 2-gene animals, and whatever offspring doesnt look like a lesser or blue eye lucy MUST be a super het daddy. (and for the minimal chance that super daddy is lethal/absent, which i dont believe since the gene is sooooo subtle, you could prove that out with the same pairing: you should then only get super lessers and lesser het daddy, with 33%/66% odds, and never get anything else).
Kurt, eaisier to say Platty x Platty which gives you three possible outcomes: Platty, SuperLesser and SuperDaddy
SuperDaddy has been done. RDR did it in... 2004 I think and has done it a couple times since as well. The super is phenotypically not much to look at, I dare say 99.5% of people would say it is nothing more than a normal. But like I said, weakest allele in the BluEL clade.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Het Platty?
 Originally Posted by asplundii
Kurt, eaisier to say Platty x Platty  which gives you three possible outcomes: Platty, SuperLesser and SuperDaddy
SuperDaddy has been done. RDR did it in... 2004 I think and has done it a couple times since as well. The super is phenotypically not much to look at, I dare say 99.5% of people would say it is nothing more than a normal. But like I said, weakest allele in the BluEL clade.
thanks for the info Then the only question that remains is why its missing from WOBP.
This thread now caused me to open a new thread that is somehow related.... a german breeder is selling 100% het black eye lucy. Makes black-eyed lucys when it hits the fire-gene. Might be a new gene or something else.
i think i wont call anything "platinum", ever. Too many people, and old sources, say "lesser platinum" and mean "lesser". Other people say "platinum" and mean "lesser het daddy". Other people say "lesser platinum", and mean "lesser het daddy". And then people say "mojave platinum" or "butter platinum", and all sense goes out of the window, until you realize they mean "mojave het daddy" or "Butter het daddy". So whenever you hear platinum, as a response you should hear: "and genetically its what?". Since everything that has ever been online will be found forever, to avoid confusion ill go the WOBP way: recognize that "platinum" is now meaningless due to logical conflicts, and strike it down. Ill allow & use "platty daddy", two words two genes, but ill probarbly just call it "lesser het daddy"
-
-
Re: Het Platty?
 Originally Posted by Kurtilein
thanks for the info  Then the only question that remains is why its missing from WOBP.
Short answer.... WoBP has their own agenda and you can either accept it or bugger off.
 Originally Posted by Kurtilein
i think i wont call anything "platinum", ever. Too many people, and old sources, say "lesser platinum" and mean "lesser". Other people say "platinum" and mean "lesser het daddy". Other people say "lesser platinum", and mean "lesser het daddy". And then people say "mojave platinum" or "butter platinum", and all sense goes out of the window, until you realize they mean "mojave het daddy" or "Butter het daddy". So whenever you hear platinum, as a response you should hear: "and genetically its what?". Since everything that has ever been online will be found forever, to avoid confusion ill go the WOBP way: recognize that "platinum" is now meaningless due to logical conflicts, and strike it down. Ill allow & use "platty daddy", two words two genes, but ill probarbly just call it "lesser het daddy" 
If you know the full history of Platty it all makes sense. Read RDR's pages for the full version but in brief; Lesser Platinum is the proper name for Lessers, RDR coined it when the first clutch from PlattyDaddy hatched out because the obviously visual offspring were "less than" Platinums. But as is common for BP breeders, everyone got lazy and just started calling them Lessers. The enigma of the Daddy gene boggled so many minds that it got bastardized over the years but RDR has been pretty consistent in calling it Daddy (Like when he made the Butter version, he called them ButterDaddy) and he has taken to calling the gene carriers het Daddy. The only divergence is where he calls the PhantomDaddy "Phantom44" because they were produced in clutch 44 of that year.
 Originally Posted by Kurtilein
This thread now caused me to open a new thread that is somehow related.... a german breeder is selling 100% het black eye lucy. Makes black-eyed lucys when it hits the fire-gene. Might be a new gene or something else.
I just discussed a similar occurrence on a different forum. I would bank on it being just another allele in the hetBlkEL complex. What is the phenotype of the BlkEL it makes? High/low/no-orange? That would tell you where it likely lies in the spectrum of the known hetBlkELs
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Het Platty?
 Originally Posted by asplundii
I just discussed a similar occurrence on a different forum. I would bank on it being just another allele in the hetBlkEL complex. What is the phenotype of the BlkEL it makes? High/low/no-orange? That would tell you where it likely lies in the spectrum of the known hetBlkELs
here it is: http://ball-pythons.net/forums/showt...acts-with-fire the thread is already in full swing.... the problem is, i already know that there are 3 other genes in the complex: sulfur, vanilla and disco, and there are also other fire-lines. The breeder is like the opposite of NERD, if it turns out to be something already known he will shift to calling it that, and if nothing happens he will just keep producing them and calling them "het black eye leucystic (M&S-line)". He named pinstripe, in the process of writing a book in which he included Brian Barczyks awesome new codominant/whatever morph, also he was one of the first customers of pinstripe and the one bringing it to europe. But he wont name his own stuff, even if its not nearly as subtle as "het daddy". He just describes what it does and whats proven about it and keeps selling it.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|