Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 591

0 members and 591 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Page 2 of 2 FirstFirst 12
Results 11 to 19 of 19

Thread: Het Platty?

  1. #11
    Registered User DG76's Avatar
    Join Date
    03-24-2013
    Location
    Zombieland
    Posts
    45
    Thanks
    20
    Thanked 8 Times in 8 Posts
    This confuses me

    does the gene act like a recessive and a co-dom ?

  2. #12
    BPnet Veteran Coleslaw007's Avatar
    Join Date
    10-27-2011
    Location
    Phoenix,AZ
    Posts
    3,037
    Thanks
    2,666
    Thanked 1,789 Times in 1,214 Posts
    Images: 8

    Re: Het Platty?

    The way I understand it, it's like an invisible codom that only shows when combined with the BEL genes. Idk if that made any sense, I understand it lol.
    Balls:
    *0.1 Mojave *0.1 Pinstripe *0.1 Bumblebee *1.0 Super pastel butter *1.0 Mojave orange ghost *0.3 100% het orange ghosts *0.1 Pastel 50% het orange ghost *1.1 PE Lemonback fires *1.0 Fire *0.1 Pastel *1.0 Albino *0.1 Spider 100% het albino
    Other critters:
    *1.0 Anery motley corn *G. rosea tarantula *G. pulchripes *P. metallica *0.0.2 A. versicolor *C. cyaneopubescens *A. geniculata *B. smithi *B. boehmei *Nhandu chromatus *H. maculata *C. marshalli *1.0 Australian shepherd mix

  3. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Het Platty?

    Quote Originally Posted by DG76 View Post
    does the gene act like a recessive and a co-dom ?
    Quote Originally Posted by Coleslaw007 View Post
    The way I understand it, it's like an invisible codom that only shows when combined with the BEL genes. Idk if that made any sense, I understand it lol.
    The "Daddy" gene is simply the weakest expression hetBluEL allele in the clade. It is not totally "invisible" because people (RDR included) are now beginning to be able to pick out animals based on cryptic traits that are proving to be "Daddy."
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #14
    BPnet Veteran interloc's Avatar
    Join Date
    09-25-2011
    Location
    ontario canada
    Posts
    1,538
    Thanks
    331
    Thanked 627 Times in 410 Posts
    Images: 79

    Het Platty?

    Is there a super daddy? Surely if it is in fact a part of the BEL group then it would have a super of some sort.

  5. #15
    Registered User
    Join Date
    02-09-2013
    Posts
    2,385
    Thanks
    200
    Thanked 581 Times in 459 Posts

    Re: Het Platty?

    Yeah, at first i believed it would be something like special or het russo, like in my earlier post, but now with more pictures and the great comparison shots its clear that het daddy is weaker than any other gene in the BEL complex.


    Quote Originally Posted by Coleslaw007 View Post
    The way I understand it, it's like an invisible codom that only shows when combined with the BEL genes. Idk if that made any sense, I understand it lol.
    this is correct.

    Is there a super daddy? Surely if it is in fact a part of the BEL group then it would have a super of some sort.
    there really should be one, and it should not be hard to produce. If you breed a lesser het daddy to lesser het daddy, you get: 25% super lesser (BEL), 50% lesser het daddy, and 25% super het daddy. In such a pairing you are guaranteed to only get 2-gene animals, and whatever offspring doesnt look like a lesser or blue eye lucy MUST be a super het daddy. (and for the minimal chance that super daddy is lethal/absent, which i dont believe since the gene is sooooo subtle, you could prove that out with the same pairing: you should then only get super lessers and lesser het daddy, with 33%/66% odds, and never get anything else).


    Maybe there are so few combos with this gene on WOBP, because its too subtle to see with other genes, like for example: spider het daddy or pastel het daddy are soo subtle that the breeders have trouble distingushing it in clutches, and the guys over at worldofballpython have trouble to accept the combo because its too subtle, lost in the noise of natural variation. To get a new morph added you need to CONVINCE the people at WOBP.

  6. #16
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Het Platty?

    Quote Originally Posted by interloc View Post
    Is there a super daddy? Surely if it is in fact a part of the BEL group then it would have a super of some sort.

    Quote Originally Posted by Kurtilein View Post
    there really should be one, and it should not be hard to produce. If you breed a lesser het daddy to lesser het daddy, you get: 25% super lesser (BEL), 50% lesser het daddy, and 25% super het daddy. In such a pairing you are guaranteed to only get 2-gene animals, and whatever offspring doesnt look like a lesser or blue eye lucy MUST be a super het daddy. (and for the minimal chance that super daddy is lethal/absent, which i dont believe since the gene is sooooo subtle, you could prove that out with the same pairing: you should then only get super lessers and lesser het daddy, with 33%/66% odds, and never get anything else).

    Kurt, eaisier to say Platty x Platty which gives you three possible outcomes: Platty, SuperLesser and SuperDaddy

    SuperDaddy has been done. RDR did it in... 2004 I think and has done it a couple times since as well. The super is phenotypically not much to look at, I dare say 99.5% of people would say it is nothing more than a normal. But like I said, weakest allele in the BluEL clade.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:


  8. #17
    Registered User
    Join Date
    02-09-2013
    Posts
    2,385
    Thanks
    200
    Thanked 581 Times in 459 Posts

    Re: Het Platty?

    Quote Originally Posted by asplundii View Post
    Kurt, eaisier to say Platty x Platty which gives you three possible outcomes: Platty, SuperLesser and SuperDaddy

    SuperDaddy has been done. RDR did it in... 2004 I think and has done it a couple times since as well. The super is phenotypically not much to look at, I dare say 99.5% of people would say it is nothing more than a normal. But like I said, weakest allele in the BluEL clade.
    thanks for the info Then the only question that remains is why its missing from WOBP.

    This thread now caused me to open a new thread that is somehow related.... a german breeder is selling 100% het black eye lucy. Makes black-eyed lucys when it hits the fire-gene. Might be a new gene or something else.

    i think i wont call anything "platinum", ever. Too many people, and old sources, say "lesser platinum" and mean "lesser". Other people say "platinum" and mean "lesser het daddy". Other people say "lesser platinum", and mean "lesser het daddy". And then people say "mojave platinum" or "butter platinum", and all sense goes out of the window, until you realize they mean "mojave het daddy" or "Butter het daddy". So whenever you hear platinum, as a response you should hear: "and genetically its what?". Since everything that has ever been online will be found forever, to avoid confusion ill go the WOBP way: recognize that "platinum" is now meaningless due to logical conflicts, and strike it down. Ill allow & use "platty daddy", two words two genes, but ill probarbly just call it "lesser het daddy"

  9. #18
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Het Platty?

    Quote Originally Posted by Kurtilein View Post
    thanks for the info Then the only question that remains is why its missing from WOBP.
    Short answer.... WoBP has their own agenda and you can either accept it or bugger off.

    Quote Originally Posted by Kurtilein View Post
    i think i wont call anything "platinum", ever. Too many people, and old sources, say "lesser platinum" and mean "lesser". Other people say "platinum" and mean "lesser het daddy". Other people say "lesser platinum", and mean "lesser het daddy". And then people say "mojave platinum" or "butter platinum", and all sense goes out of the window, until you realize they mean "mojave het daddy" or "Butter het daddy". So whenever you hear platinum, as a response you should hear: "and genetically its what?". Since everything that has ever been online will be found forever, to avoid confusion ill go the WOBP way: recognize that "platinum" is now meaningless due to logical conflicts, and strike it down. Ill allow & use "platty daddy", two words two genes, but ill probarbly just call it "lesser het daddy"
    If you know the full history of Platty it all makes sense. Read RDR's pages for the full version but in brief; Lesser Platinum is the proper name for Lessers, RDR coined it when the first clutch from PlattyDaddy hatched out because the obviously visual offspring were "less than" Platinums. But as is common for BP breeders, everyone got lazy and just started calling them Lessers. The enigma of the Daddy gene boggled so many minds that it got bastardized over the years but RDR has been pretty consistent in calling it Daddy (Like when he made the Butter version, he called them ButterDaddy) and he has taken to calling the gene carriers het Daddy. The only divergence is where he calls the PhantomDaddy "Phantom44" because they were produced in clutch 44 of that year.

    Quote Originally Posted by Kurtilein View Post
    This thread now caused me to open a new thread that is somehow related.... a german breeder is selling 100% het black eye lucy. Makes black-eyed lucys when it hits the fire-gene. Might be a new gene or something else.
    I just discussed a similar occurrence on a different forum. I would bank on it being just another allele in the hetBlkEL complex. What is the phenotype of the BlkEL it makes? High/low/no-orange? That would tell you where it likely lies in the spectrum of the known hetBlkELs
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #19
    Registered User
    Join Date
    02-09-2013
    Posts
    2,385
    Thanks
    200
    Thanked 581 Times in 459 Posts

    Re: Het Platty?

    Quote Originally Posted by asplundii View Post
    I just discussed a similar occurrence on a different forum. I would bank on it being just another allele in the hetBlkEL complex. What is the phenotype of the BlkEL it makes? High/low/no-orange? That would tell you where it likely lies in the spectrum of the known hetBlkELs
    here it is: http://ball-pythons.net/forums/showt...acts-with-fire the thread is already in full swing.... the problem is, i already know that there are 3 other genes in the complex: sulfur, vanilla and disco, and there are also other fire-lines. The breeder is like the opposite of NERD, if it turns out to be something already known he will shift to calling it that, and if nothing happens he will just keep producing them and calling them "het black eye leucystic (M&S-line)". He named pinstripe, in the process of writing a book in which he included Brian Barczyks awesome new codominant/whatever morph, also he was one of the first customers of pinstripe and the one bringing it to europe. But he wont name his own stuff, even if its not nearly as subtle as "het daddy". He just describes what it does and whats proven about it and keeps selling it.

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1