Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,485

0 members and 1,485 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Page 6 of 7 FirstFirst 1234567 LastLast
Results 51 to 60 of 61
  1. #51
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6

    Re: Repticon Atlanta 09, huge any computer warning :p

    If the bone you have to pick with him is that he was selling animals that had not had their first shed then I think you need to add at least 7 other vendors (that I distinctly remember) to that list.
    My bone as you call it would be with your post talking about THAT specific seller.

    You are telling people that they are making assumption about some animal not feeding and I am telling you that some of the animals not feeding is not an assumption but a FACT
    And again I ask, how can you guarantee that all those animals he was selling had not had their first shed?Did you ask him specifically? Cause if you did not then, yeah, it is speculation. You are speculating that they had not had their first shed and therefore you are speculating that they are not eating.
    I did not say all the animals I said several of them did not have their first shed...........again not a speculation on my part, I was there I saw the animals first hand therefore I know that some of the animals did not have their first shed which mean they were not feeding nor possibly could have been guarenteed to be feeding.

    For the record I do not need to ask a seller if an animal had his first shed or not I can tell simply by looking at the animal ...........therefore not a speculation but a fact.

    Again, I am not defending his prices. But if that is the problem you have with him then just stick to that and quit making things up to add to the "crime".
    And I could not care less about his prices what I care about are YOUR statements about people speculating on some of the animals that were not feeding or could not be guarenteed to be feeding.
    Deborah Stewart


  2. #52
    BPnet Veteran Haydenphoto's Avatar
    Join Date
    06-07-2009
    Location
    Chicagoland
    Posts
    392
    Thanks
    48
    Thanked 45 Times in 40 Posts
    Images: 4

    Re: Repticon Atlanta 09, huge any computer warning :p

    Quote Originally Posted by Deborah View Post
    When an animal did not even have it's first shed (and there were several of them) this is not an animal that is feeding or that can be guarenteed to be feeding, and I strongly believe that NO ANIMAL should be sold before their first shed and had several meals in them.

    The animal not eating is in no way speculation it is a fact see above.
    How do you know they have not had there first shed ???

  3. #53
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6

    Re: Repticon Atlanta 09, huge any computer warning :p

    Quote Originally Posted by Haydenphoto View Post
    How do you know they have not had there first shed ???
    Because hatchling have a very distinctive look to them before they have their first shed.....they are very shiny, they lose that shine afte their very first shed. (If you want to know what I am talking about let me know I will PM you some pictures for comparison)
    Deborah Stewart


  4. #54
    Registered User gp_dragsandballs's Avatar
    Join Date
    03-28-2009
    Location
    Grants Pass, OR
    Posts
    164
    Thanks
    51
    Thanked 32 Times in 27 Posts

    Re: Repticon Atlanta 09, huge any computer warning :p

    Nice pics of the expo.

    I can't wait til the Sacramento expo it was alot of fun last year.

    About the hatchling thing, they are incredibly shiny before there first shed. Kinda makes you disappointed when they do shed and dull a bit.

  5. #55
    BPnet Veteran Haydenphoto's Avatar
    Join Date
    06-07-2009
    Location
    Chicagoland
    Posts
    392
    Thanks
    48
    Thanked 45 Times in 40 Posts
    Images: 4

    Re: Repticon Atlanta 09, huge any computer warning :p

    Quote Originally Posted by Deborah View Post
    Because hatchling have a very distinctive look to them before they have their first shed.....they are very shiny, they lose that shine afte their very first shed. (If you want to know what I am talking about let me know I will PM you some pictures for comparison)
    Well from what i can see in the pic of the 250$ lessers they look a little bigger the brand new baby's i could be wrong but they look a little big in the pic !

  6. #56
    BPnet Veteran twistedtails's Avatar
    Join Date
    05-11-2009
    Location
    Southern California
    Posts
    1,927
    Thanks
    369
    Thanked 455 Times in 358 Posts

    Re: Repticon Atlanta 09, huge any computer warning :p

    Quote Originally Posted by Haydenphoto View Post
    Well from what i can see in the pic of the 250$ lessers they look a little bigger the brand new baby's i could be wrong but they look a little big in the pic !
    For the price and size, like I said, I would have been all over those(picky eaters or not).

  7. #57
    BPnet Veteran Haydenphoto's Avatar
    Join Date
    06-07-2009
    Location
    Chicagoland
    Posts
    392
    Thanks
    48
    Thanked 45 Times in 40 Posts
    Images: 4

    Re: Repticon Atlanta 09, huge any computer warning :p

    Quote Originally Posted by twistedtails View Post
    For the price and size, like I said, I would have been all over those(picky eaters or not).
    I would of had all of them

  8. #58
    Registered User grammie's Avatar
    Join Date
    11-12-2008
    Location
    in the empty nest
    Posts
    321
    Thanks
    157
    Thanked 40 Times in 33 Posts
    Images: 10

    Re: Repticon Atlanta 09, huge any computer warning :p

    I thought it was a great show and tons of critters there!! I came away with 6 new geckos. Does anyone know the vendor at the big table near center front that had so many lizards? I wish I had thought to get name/card, but hubby was way ready to go by then.

  9. #59
    Registered User
    Join Date
    08-22-2008
    Location
    Atlanta, GA
    Posts
    65
    Thanks
    4
    Thanked 3 Times in 3 Posts

    Re: Repticon Atlanta 09, huge any computer warning :p

    yeah it was a neat show with a lot going on.

    As for the guy with the $250 lessers I will say his pastels were looking a bit iffy but at least the lessers were pretty well started. I held some of his stuff and they had a bit more chunk to them than the rest.

    His stuff was nice but there was this older lady at the front without much of a display who had some kick-butt lessers that were gorgeous. She wanted $550 for them and they were worth every penny.
    I'm gonna kill the ice cream man.

  10. #60
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Repticon Atlanta 09, huge any computer warning :p

    Okay, it seems I am just a little too / for the rest of the wolrd to understand me so let me try again

    To get anywhere with me you need two things: Credibility and Consistence

    So, first we discuss Credibility

    My initial post was directed at people who were not there (like people from Ohio or Scotland...) but were talking as if they had been.

    Those people were stating things as if they were fact when all it really was was speculation.

    Those were the statments I was contending with.


    Quote Originally Posted by Deborah View Post
    My bone as you call it would be with your post talking about THAT specific seller.
    IF you have an issue with me telling people who were not there and therefore lack all the info that maybe they ought to hold off on speculation then I do not know what I can do about that. But maybe you could have come to me via PM rather than making your personal issue with me a public one.

    You are telling people that they are making assumption about some animal not feeding and I am telling you that some of the animals not feeding is not an assumption but a FACT
    Sorry Deborah but I am correct here. People who were not there making statements about things they do not know are making assumptions.

    And granted, some of his animals may have been pre-first shed. However, that does not change the fact that those people who were not there know nothing about the animals that were sold as guaranteed feeders. And neither do you for that matter cause you were not standing there when I heard that comment made. And I never said what animal it was that was sold with that guarantee.

    So... Your credibility that the animals sold as guaranteed feeders were not is, I am sorry to say, lacking.

    I did not say all the animals I said several of them did not have their first shed...........again not a speculation on my part,
    You are correct, I mis-read and thought you were making a more sweeping statement.

    I was there
    What is your point? I was there too.

    I saw the animals first hand therefore I know that some of the animals did not have their first shed which mean they were not feeding nor possibly could have been guarenteed to be feeding.
    And again, without knowing what animals were sold as guaranteed feeding (a fact you lack cause you were not there at that moment) then you cannot say they were not feeding.

    For the record I do not need to ask a seller if an animal had his first shed or not I can tell simply by looking at the animal ..........
    Do you think that I, in my 28 years keeping have no clue what a pre-first shed animal looks like? How do you think I know that 7 other vendors had pre-first shed animals??

    therefore not a speculation but a fact.
    Not speculation that some of the animals were pre-shed. But speculation that the ones I said were sold as guaranteed feeders were necessarily some of those pre-shed animals.

    And I could not care less about his prices what I care about are YOUR statements about people speculating on some of the animals that were not feeding or could not be guarenteed to be feeding.
    And as I have, I hope, made a bit more obvious, people, including yourself, were making assumptions about the animals sold as guaranteed feeders. Without you either having been standing there at the same time I was or me telling you exactly which animals it was that I saw sold then you lack the information to say that they were those pre-shed, non-feeding animals.


    Now, consistency

    Quote Originally Posted by Deborah View Post
    When an animal did not even have it's first shed (and there were several of them) this is not an animal that is feeding or that can be guarenteed to be feeding, and I strongly believe that NO ANIMAL should be sold before their first shed and had several meals in them.
    Your quote, I added the colour.

    Now, I have stated that there were 7 other vendors that I can distinctly recall also having pre-shed animals there. The albinos in the first set of pics are among them. Now, not a single person in this thread, yourself included, has made any comment on how those vendors are questionable. Why is that?

    This is why I have an issue with the pre-first shed thing being brought up in relation to this seller. If it is such an issue, and you sure seem to make it out to be, then it ought to be applied to every vendor that does it, regardless of the price of the animal. As it stands, the matter is irrelevant to how low this particular vendor was selling. And yet it is being bandied about by people making baseless speculation.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 6 of 7 FirstFirst 1234567 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1