» Site Navigation
1 members and 1,838 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,086
Threads: 249,226
Posts: 2,572,838
Top Poster: JLC (31,651)
Welcome to our newest member, diingoo
|
-
Re: I Attended the HR2811 Hearing on July 29th
 Originally Posted by Adam_Wysocki
Is there something special about Florida burmese owners that compels them to release their snakes into the environment and yet burmese python owners in the other 47 continental US states are able to restrain themselves?
Florida is the only state with a feral population of burmese ... according to your statements, there should be other states with the same problem but there are none.
Personally, I don't see any definitive evidence one way or the other (hopefully I'm entitled to my own opinions), but I do find it hard to believe that Florida is the only state where burmese python owners let their animals go into the environment. I can't help but wonder why other states that supposedly can support wild populations of burms don't already have a problem?
-adam
"Supposedly" is the key word. I think that the battle cry of the reptile nation has been that there is little chance of most other states being able to support a wild population.
The Everglades (and Florida) in general has been able to support a wide variety of non-native species due to it's tropical climate. Peacock bass, festae and other tropical fish are established as are varanids and iguanids.
Except for a few other southern states, where else would these animals have a chance of thriving? According to the Reptile Nation - nowhere - and I agree.
It's a multi-faceted issue that deals with supposed threats to the environment and personal safety. After going to few reptile shows and seeing what is being sold to whom, I am firmly of the belief that the sale and ownership of venomous snakes and large/potentially dangerous reptiles should be restricted.
As tot he threat to the environment, regardless of how Florida became populated non-native reptiles, it still illustrates how they can gain a toe-hold a thrive. USARK is having to deal with a deck of cards with no aces - you can't explain away what's happened - non-reptile people don't want to hear it.
So they have to minimize the damage and save ball python and other boid owners by sacrificing some of the rights of the burm and afrock keepers. I get it, I just wonder how long it will be before they aren't the voice of the Reptile Nation anymore.
-
-
BPnet Veteran
Re: I Attended the HR2811 Hearing on July 29th
Thanks Colin, great to know your on our side!!! See you @ Hamburg!
-
-
BPnet Veteran
Re: I Attended the HR2811 Hearing on July 29th
 Originally Posted by Skiploder
As for the government banning our dogs and cats - where's your proof?
The government might not be pusing for it but organzations like PETA and HSUS are. Tey see it as a sort of animal slavery and people shouldn't be allowed to keep pets. If they just started with cats and dogs people would think there nuts. Wy do you think they supported HR669? They thought they'd start on the opposite side of the spectrum. They didn't realize that so many people would be against it tought so now tey are trying to start wit animals that are big and scarey, "monsterous alligator eating pytons". Then tey are going to push bills to ban other "dangerous animals". From there they are going to pus there way down te spectrum until tey reach cats and dogs and nobody and legally own any pet! Of course I seriously doubt tey would ever get that far but they will try. PETA and the HSUS are not what you think they are.
-
The Following 2 Users Say Thank You to Brewster320 For This Useful Post:
-
Re: I Attended the HR2811 Hearing on July 29th
Hi,
O.k - firstly this post contains nothing but personal opinion. I'm still allowed one so if anyone gets upset please target all missiles and barbs at me alone.
 Originally Posted by DutchHerp
One thing really bugs me... the "Reptile Nation" won't take responsiblity for what they've done.
Take the Barkers, for instance.
They stay there are no records of people releasing burmese pythons in the wild of Florida. Like the bastard that does will report himself, right?
Then, they try to blame it on a) hurricanes blowing down zoos and b) imported babies - yay, affecting even MORE ecosystems! - escaping from airports.
C'mon, people.
These snakes were released by irresponsible buttholes of reptile owners.
People would not have to "report themselves" for there to be a record - getting caught or even seen would do it. Heck, even third party gossip would likely be trumpeted from the rooftops in the current climate.
Now considering you are planning on studying these things I take it that means you can guestimate the intial numbers needed to create a population of 100,000+ within 20 years without any observed problems with genetic diversity?
Can you, even for a second, seriously believe that it is less likely that hurricane damage in an area with import warehouses, zoos and breeders collections would release a large number of burmese pythons than the notion that the same number of individual keepers all spontaneously decided to drive to florida and release their snakes?
"C'mon" indeed.
 Originally Posted by DutchHerp
They are competing with the native wildlife - which is already having a tough time with all the other thousands of imported species - to survive in THEIR NATIVE HABITAT.
But hey, according to the Barkers, it cannot be said they'll have a negative impact on the Everglades!
Can you people do simple math? Burmese pythons eat food... food that native species would eat... add these two together, and you'll figure out in a short time - well, unless you're not very bright - that native species will have an even harder time finding food.
Well, since I am apparently not very bright, can you explain why predators capable of eating an animal within the range eaten by a burmese throughout its life would be incapable of eating a baby or juvenile burmese? It is quite a large range of prey sizes when all is said and done and a baby burmese is hardly an invincible monster.
There are after all other reptiles of similar size that have been suffering predation in that area for some considerable time. Since this is an apparently exploding population it must logically be comprised of a higher amount of younger (therefore smaller ) examples than older mature animals - wouldn't that mean it is theoretically more likely that, numerically, burmese pythons are more of a food source than you are crediting?
And can you please stop insinuating that anyone who doesn't agree with you is not very bright or cannot do simple maths?
It is very annoying coming from someone plainly inhaling the fumes from the wrong end of his high horse.
 Originally Posted by DutchHerp
The burms are there to stay. Banning pythons won't stop that.
It will, however, prevent other burmese/african rock/whatever pythons from populating yet another area.
Instead of saving our right to keep these animals in cages, the Reptile Nation should fight for natural ecosystems and preserve them.
Later, Matt
Which other area? Be specific if possible.
And if there are in fact 100,000+ animals already in situ then the number of animals that could be expected to be added by escapes or deliberate release by irresponsible keepers is statistically and practically utterly, utterly insignificant.
If the burms are here to stay then there is no pristine ecosystem that can be reverted to.
[RANT]
As a matter of fact there never was - ecosystems have been altered and shaped by mankinds actions since we planted the first crop. The everglades included - the billions they are spending are to try and revert it to a point in time they have chosen arbitrarily.
To believe that any ecosystem can be isolated enough to be fully restored to a time before human intervention and preseved in a kind of stasis is the same kind of farcical, wooly minded miscomprehension of the natural world that fills the minds of the animal rights lunatics.
Nothing in nature is stable long term, there was no mythical Eden that we must strive to recreate and protect. If your plan and desire is to artificialy and arbitrarily create and maintain a false construct at least have the decency to admit it and refrain from denegrating people who do not share your desires.
[/RANT]
Once again, these are my views not the views of BP.net.
dr del
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
The Following 17 Users Say Thank You to dr del For This Useful Post:
- + Show/Hide list of the thanked
-
Alice (07-31-2009),asplundii (07-30-2009),Denial (07-31-2009),Fallout32 (07-30-2009),Freddiesinmyseat (07-30-2009),GregBennett (07-31-2009),hross (07-30-2009),JLC (07-30-2009),Kara (07-31-2009),kenneally1 (07-31-2009),Mendel's Balls (07-30-2009),Muze (07-30-2009),neilgolli (07-30-2009),rabernet (07-30-2009),Russ Lawson (07-30-2009),tweets_4611 (07-30-2009),waltah! (07-30-2009)
-
Re: I Attended the HR2811 Hearing on July 29th
 Originally Posted by dr del
Once again, these are my views not the views of BP.net.
Well Dr. Del I can say that while the words typed my be your own the view is not yours exclusively because I, at least, agree with you. And I would guess more than a few others do as well
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: I Attended the HR2811 Hearing on July 29th
 Originally Posted by asplundii
Well Dr. Del I can say that while the words typed my be your own the view is not yours exclusively because I, at least, agree with you. And I would guess more than a few others do as well
Hear, hear!
 _____________________________________________
Ivy
_____________________________________________
BPs: 1.0 Normals,1.0 Pastels, 0.1 Dinkers
Other Herps:
6.20 Bearded Dragons (Hypos, Trans, Leathebacks, Reds, etc.), 1.1 Knob Tail Geckos
Other:
0.1 Mini American Eskimos, 1.0 Chihuahuas, 0.1 Terrier Mixes, 1.0 Chihuahua/Toy Fox Terrier Mixes
1.0 Double Rex, 0.1 Beige Ruby Eyed Dumbo, 0.1 Hairless PEW
-
-
Re: I Attended the HR2811 Hearing on July 29th
 Originally Posted by asplundii
...
Claims of potential expansion throughout the U.S. by invasive python species are contradicted by ecological niche models by Pyron et al.
http://www.pubmedcentral.nih.gov/art...medid=18698351
Plus, it was published in a peer reviewed journal. Give it a bit more credibility. (Not that I do not think the Barkers are credible, they are. But the population at large is hesitant to "believe" unless it is published in a real journal.)
The original USGS report was severely flawed because it only looked at two climatic variables--mean temperature and mean precipitation. This approach does not take into consideration the variability of local climate conditions--for example, the number of days with extreme low temperatures.
The paper on you cite above, on the other hand, considers 19 climatic variables and gives us a more accurate model of reality.
From that paper's discussion:
"Figure 3 of Rodda et al. [2] illustrates the prediction for the Burmese python in its current native range, and includes vast areas where the python has never been recorded in modern times, including Afghanistan, Borneo and the Arabian peninsula. The fact that their model makes such inaccurate predictions of the current distribution in the native range of this species questions the use of their model in identifying potential areas of future invasion. Modeling the ecological niche of organisms solely as a function of mean temperature and precipitation omits the critical interactions between these variables that define the fundamental and realized niche which organisms inhabit [12], [13]. If species were able to expand into environments simply based on mean precipitation and temperature conditions similar to those in their native range, the continental United States should be overrun by the northward expansion of subtropical species such as the Boa Constrictor, found only 145 km south of the Texas border.
We do not intend to downplay the critical problems that invasive wildlife pose for native ecosystems, or the possible impact that global climate change may have on the environment. The establishment of the Burmese python in the Everglades poses a serious risk to the balance of the park's ecosystem. However, the results from the ecological niche modeling suggest that the possibility for the expansion of the species into the rest of the United States is vastly overstated, and citizens throughout most of North America should have no fear of giant snakes invading their neighborhoods. Based on our results, the methods and predictions of Rodda et al. [2] seem particularly imprecise and do not appear to represent an accurate picture of the threat posed by the Burmese pythons. The alarmist claims made by the USGS could potentially hamper scientific discourse and inquiry into the problem, especially with regard to policy-making. Here, we have demonstrated that the suitable niche for the Burmese Python in the United States is minimal, based on available data regarding the current distribution of the snakes. Additionally, global warming is projected to have a negative effect on the species' continued survival. Climate change models indicate that the effects of global warming will result in a drastic decrease in the suitable habitat for the Burmese python, both in the United States and its native range. These serious problems do not benefit from any potential exaggeration of possible threats to the public and the legislature."
Here's the picture of the potential US range of the Burmese python their model predicts from global warming.
Last edited by Mendel's Balls; 07-30-2009 at 12:22 PM.
~ 1.0.0 Python regius ~ Wild-type ~
~ 1.0.0 Canis familiaris ~ Blue Italian Greyhound ~
~ 0.0.9 Danio rerio~ Wild-type and Glofish

-
-
Registered User
Re: I Attended the HR2811 Hearing on July 29th
My personal opinion is that the truth lies somewhere between. The snakes may have gotten to the everglades from hurricaine damage and from idiots letting their snakes go. I live in Missouri and we just found out a nearbly man-made recreational lake has two large alligators alligators swimming around that they are trying to catch. I know how easy it is to buy a baby alligator online. Surely someone bought one and later realized they couldn't handle it...and let it go. If I was irresponsible enough to do something like that I would think I would still be smart enough to be sneaky about letting the alligators go. You can stop the car by the lake at night, somewhere out of the way with no other people...it would be a cinch. I don't think anyone is dumb enough to pull over on a busy road in broad daylight and drop-kick a 20-foot snake out of their trunk.
Maybe the hurricaine contributed a little or a lot of the snakes...but I know there are a lot of irresponsible pet owners that just let them go.
I have little kids and I don't want my neighbors owning potentially lethal animals (whether they are lions, bears or burms) IF they don't know how to keep them. I think a workable law would allow licensed keepers to keep the animal if they passed regular inspections looking at their cage setup...
-
-
BPnet Veteran
Re: I Attended the HR2811 Hearing on July 29th
Each time there is a ban, its not just a ban, its a freedom being taken away from you. Give me Life, liberty, and the pursuit of happiness.
-
-
BPnet Veteran
Re: I Attended the HR2811 Hearing on July 29th
You guys are probably going to view this as a "*****ing out" post...
I have an opinion, and I have my own arguments to support that.
I have many, many paragraphs to attend if I indeed do want to defend myself... and then it'll start all over again.
Like me or dislike me, I couldn't care less.
The pet trade - whether the animals are in zoos or imported or kept in other cages - is responsible for the burmese problem.
Whether it's a hurricane or not, the burmese pythons "escaped" because they were already in captivity in Florida.
The Reptile Nation can take responsibility, or not...
Later, Matt
MH
Who the hell is Pat?
"Pattimuss doesn't run, he prances most delicately, like a beautiful but sad fairy, winged and capped, curly toed shoes on each foot, dancing on dewdrops while lazy crickets play soft music for him to keep time by...." - Wes
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|