» Site Navigation
1 members and 551 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,117
Posts: 2,572,190
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Re: Do all morphs have diffrent personalities?
 Originally Posted by Spaniard
I am however happy that this spurred the discussion it did since I think some good information was shared.
x2! This has been a great discussion!
-
The Following User Says Thank You to kc261 For This Useful Post:
-
Re: Do all morphs have diffrent personalities?
Damm what a mind storm... LOL
You know i just think that if some people say that every spider wobble you can say that every ball wobble a liitle bit. Dont You think so ??
-
-
Re: Do all morphs have diffrent personalities?
 Originally Posted by Freakie_frog
Really?? very cool I did not know that..I wonder what effect if any that repaired DNA would have on the animal?
In theory, repaired DNA should have no effect as it should be just that -- repaired, fixed, same as normal 
If the repair fails, the cell cycle should abort and the cell should be destroyed. If this fails, that's when you get mutation ...
It IS possible to have an "insertion mutation," in which you have extra base pairs inserted into the middle of a gene, or a deletion, in which case base pairs are deleted. However, I still don't see how another mutated gene could somehow "fix" that mutation, unless the mutation was recessive and the mutated gene just happened to miraculously code for the same protein as is defective in the first mutation. ... Just don't see that happening with the spider/neuro mutations.
That's very interesting that there are phenotypically normal spider sibs that show neuro signs -- definitely puts up a "plus one" to the linkage theory in my book ...
-
-
Re: Do all morphs have diffrent personalities?
 Originally Posted by Freakie_frog
Really?? very cool I did not know that..I wonder what effect if any that repaired DNA would have on the animal?
 Originally Posted by Serpent_Nirvana
In theory, repaired DNA should have no effect as it should be just that -- repaired, fixed, same as normal 
Serpent beat me to it but he is correct. Repaired DNA should be no different from what it looked like before. There are some cases where the repair system glitches and you get a point mutation. However, for DNA damage to happens in every cell at the exact same place at the exact same time would be an almost impossible occurrence and to have all those damaged areas mis-repaired in the exact same way would be bordering on the near to infinitely impossible... So, the only way one of these mismatch point mutations is going to become obvious is if it occurs in a gamete and is later passed on. In most cases this is not going to make an obvious change but in some cases it may be the cause of a spontaneous mutation.
 Originally Posted by Spaniard
So I've gone back and looked up some threads in hopes that I would find the mention of combos showing less wobbles. I know I've read it numerous times and was trying to see who the source was just out of my own curiousity. I couldn't find anything (figures) but I know I didn't pull the information out of the air.
I never thought you pulled this idea out of thin air I have heard this rumor tossed around a few times. I think it is just something that is bound to happen when you are discussing a topic as volatile as the "wobble" in spiders. Like I said in an earlier post, the "wobble" is a stigma in this morph. In reality it probably should not be and if it had not been kept a "secret" in the early days then it probably would not have been. I think the best thing for the hobby in general would be to just embrace the fact that "wobble" goes with spider. If everyone just accepted it then there would not be a need for rumors to pop up around it.
I know when I'm wrong and for the record I would like to retract this statement made above...
I agree with asplundii saying it was too much of a blanket statement. I am however happy that this spurred the discussion it did since I think some good information was shared.
I was not trying to beat you down and I apologize if I came off that way. Sometimes I get a little overzealous.
 Originally Posted by kc261
x2! This has been a great discussion! 
You will not get any argument from me. It has been a great discussion and I have enjoyed it
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Do all morphs have diffrent personalities?
No problem, a beat down here and there never hurt anybody
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
-
Registered User
Re: Do all morphs have diffrent personalities?
i heard somewhere that spiders have quite a voracious feeding response, mine has never missed a feed since i got it as a baby, (apart from breeding)
-
-
Re: Do all morphs have diffrent personalities?
My male spider ate like a blood python. My female seems to want live but I'm hoping I can convert her over ...
I'm curious, though -- I had thought that the OP was asking if individual morphs have different personalities (as in, spiders are friendly, albinos are jerks, etc) ... Has anyone noticed this to be the case? I have heard that pieds tend to be terrible eaters, but that's about the only "personality" type association I've heard of.
(I know of course all of that is total hearsay, no scientific basis whatsoever, but I am curious as to what trends other morph owners may have noticed...)
-
-
Re: Do all morphs have diffrent personalities?
When I got my woma I asked the breedier if the morph had any quirks and he said that like spiders they were vicious eaters.
I have heard the rumor that pied could be difficult.
Beyond those and the already mentioned caramels and supper cinny/black pastels I have not heard of any morph quirks
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Do all morphs have diffrent personalities?
The breeder I got my mojave from said BHB told him all his mojaves are great eaters. I only own one but she never turns down a meal. I think she would stuff herself to the rim if I let her.
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
-
BPnet Veteran
Re: Do all morphs have diffrent personalities?
all of you have been amazing with information!! I am glad i started this thread it has beeen so helpful filled with great responses i thought i was going to get a simple answer but instead i got more information than my brain can digest!! i find myself reading it over and over to make sense of it all. I dont like the thought that out there in the wild or someones dinker project can form another gorgeous python with some type of neurological disorder or any disorder for that fact that might be sever to the point the ball python cant survive we might run into it we might not but you never know again thanks for all the great input guys! i have alot of + rep to give out lol
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|