» Site Navigation
0 members and 3,536 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,097
Threads: 248,540
Posts: 2,568,748
Top Poster: JLC (31,651)
|
-
Re: How leopard affect other genes
Originally Posted by JodanOrNoDan
From what I heard from Nerd, a "Super" Leopard was produced by someone, don't recall the name, but what is actually a homozygous dominant. No visual change, just produces 100% Leopards.
Has something changed?
I would say its along the lines of the super enchi, super banana, super ghi where the super doesn't change the appearance but merely the offspring are 100% visuals.
Sent from my SM-G955U using Tapatalk
1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown
-
-
Re: How leopard affect other genes
and both are just so beautiful in their own rite.
you and your babies are p much the reason i wanted to work with the Leopard gene, and why i chose one of your babies to be my Matriarch.
you're an inspiration Deb!!!
4.4 ball python
1.0 Albino ✮ 0.1 Coral Glow ✮ 0.1 Super Cinnamon paradox ✮ 1.0 Piebald ✮ 0.1 Pastel Enchi Leopard het Piebald ✮ 1.0 Coral Glow het Piebald ✮
1.0 corn snake
1.0 Hypo ✮
1.0 crested gecko
0.1 ???? ✮
0.1 cat
0.1 Maine Coon mix ✮
0.1 human ✌︎
-
The Following 2 Users Say Thank You to tttaylorrr For This Useful Post:
Craiga 01453 (07-20-2018),the_rotten1 (07-21-2018)
-
Re: How leopard affect other genes
Originally Posted by Turbo Serpent
I would say its along the lines of the super enchi, super banana, super ghi where the super doesn't change the appearance but merely the offspring are 100% visuals.
Sent from my SM-G955U using Tapatalk
All of those are co-doms.There is a visual difference in the "Supers". Leopard was dominant last time I heard.
My snakes...
Enchi...
Super Enchi
Honest, I only need one more ...
-
The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:
C.Marie (07-22-2018),the_rotten1 (07-23-2018)
-
Re: How leopard affect other genes
I've never really noticed much of a difference between enchi and super enchi, I always thought it to be the same.
Sent from my SM-G955U using Tapatalk
1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown
-
-
Amazing babies. I'm of the opinion that leopard makes everything better and this makes me want to add some lesser and coral glow to my collection. Your hatchlings are inspirational.
~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~
Check me out on iHerp, Instagram, & visit my store!
-
The Following User Says Thank You to the_rotten1 For This Useful Post:
-
Re: How leopard affect other genes
Originally Posted by the_rotten1
Amazing babies. I'm of the opinion that leopard makes everything better and this makes me want to add some lesser and coral glow to my collection. Your hatchlings are inspirational.
Thanks, Leopard has definitely become one of my favorite gene to work with since buying my first one in 2012, now all I have to do is incorporate it in my Clown stuff (which is on the way since this year I did Pastel Leopard Clown X Leopard)
Last edited by Stewart_Reptiles; 07-21-2018 at 11:48 AM.
-
The Following 4 Users Say Thank You to Stewart_Reptiles For This Useful Post:
AlexisFitzy (09-03-2018),C.Marie (07-22-2018),the_rotten1 (07-23-2018),tttaylorrr (07-21-2018)
-
Re: How leopard affect other genes
Love the leopard morph and what it does. Awesome pics.
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to ceh23 For This Useful Post:
-
Re: How leopard affect other genes
Originally Posted by JodanOrNoDan
From what I heard from Nerd, a "Super" Leopard was produced by someone, don't recall the name, but what is actually a homozygous dominant. No visual change, just produces 100% Leopards.
Has something changed?
Graziani was the first to publicly comment on Leopard being a strict dominant type mutation with a homozygous that was not visually distinct from the heterozygous. He and I discussed it on ReptileRadio back in... I want to say early 2014.
Kobylka has since put out a video wherein he said that he thinks there is a very subtle difference between the heterozygous and the homozygous, at least in some of the combos he has made. The trouble there is that all the animals he showed in the video were from Leo x Leo clutches and therefore only considered possibly homozygous and to the best of my knowledge neither he not anyone else has subsequently bred them out to confirm if his supposition was correct.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
JodanOrNoDan (07-23-2018)
-
Re: How leopard affect other genes
Originally Posted by Deborah
Leopard has been listed has Dominant since it first appeared however Super Leopard have been produced.
Originally Posted by JodanOrNoDan
From what I heard from Nerd, a "Super" Leopard was produced by someone, don't recall the name, but what is actually a homozygous dominant. No visual change, just produces 100% Leopards.
Has something changed?
Originally Posted by asplundii
Graziani was the first to publicly comment on Leopard being a strict dominant type mutation with a homozygous that was not visually distinct from the heterozygous. He and I discussed it on ReptileRadio back in... I want to say early 2014.
Kobylka has since put out a video wherein he said that he thinks there is a very subtle difference between the heterozygous and the homozygous, at least in some of the combos he has made. The trouble there is that all the animals he showed in the video were from Leo x Leo clutches and therefore only considered possibly homozygous and to the best of my knowledge neither he not anyone else has subsequently bred them out to confirm if his supposition was correct.
i asked this awhile back: https://ball-pythons.net/forums/show...pard&p=2535369 and here's the vid:
Originally Posted by Turbo Serpent
I would say its along the lines of the super enchi, super banana, super ghi where the super doesn't change the appearance but merely the offspring are 100% visuals.
there are differences. i've noticed higher whites and softer colors overall in the Super Banana/Super CG and the Super GHI is super dark, looks to be in shed w/o the blue-ness.
Originally Posted by Turbo Serpent
I've never really noticed much of a difference between enchi and super enchi, I always thought it to be the same.
the pattern is cleaner, bolder but the biggest difference is in the eyestripe and neck pattern.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following 2 Users Say Thank You to Ax01 For This Useful Post:
JodanOrNoDan (07-23-2018),Turbo Serpent (07-23-2018)
-
Registered User
Re: How leopard affect other genes
Wow that first banana looks like it has tri stripe in it! Very beautiful boy.
Sent from my SM-G930V using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|