» Site Navigation
0 members and 1,657 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,102
Threads: 249,247
Posts: 2,572,954
Top Poster: JLC (31,651)
|
-
Re: What are Pieds? (Jinx)
I forgot to mention; Some the markers (except for the white ring marker on het pieds), the train track for example, is shown and found in animals that is proven to be not het for pied. That alone proves that the het pied is not the cause of it, but rather have a ripple effect when coming in contact with that gene/s.
The ring on het pied might be another reaction that occurs when the het pied gene comes in contact with another type of gene/s that is not visibly displayed. If that other gene/s in not present, neither will the marker, and the het pied gene alone will thus be recessive only.
Until it is proven, it is only a theory, until someone takes this seriously and stop babbling on how many animals they have seen and how much they think they know I will only consider it all to be opinions, not proof.
-
What are Pieds? (Jinx)
I want a curly tail floppy ear Russian pet fox. If I under stand what you were saying about them the Russians have made foxes into pets! I know I'm off topic but I didn't know about the pet foxes till now :(
-
Bunnykit - that was a very long post, and all I really got out of it was that you want to use another term that is not part of genetic lingo (at least that I have heard), which really in not needed, as we have terms to describe what is happening.
No one is denying that other genes play a part. Your argument would be more true for the Pied if it only affected certain morphs with its visibility. It affects all morph and normals. Just as a inc-dom should. The degree of this effect is variable as it is with all subtle morphs. People keep bringing up no so subtle morphs like Spider, Mojave etc... when it is the subtle that should be compared, like Specter.
(side note: Spider is still not technically proven dominant)
This does not apply to what we still believe may be true recessive like Albino. You can pile on as few or as many genes as you like (the oddball ones that color up different as outliers) and still not see that the het Albino is carrying anything else. This is just not the case for het Pied and really so far for het Clown.
Now, if one were to ask the question "Are some morphs more inherently unstable and easily affected by other morphs" the answer to that is "yes", but really that does not apply here since het Pied seems to visually affect most everything.
Let us talk about markers for a moment. The key to a subtle mutation is that while you may not be able to pinpoint EXACTLY what is off (as far as ID of the morph) but you surely be able to see the SOMETHING is different from the normal appearance. IF you can SEE this difference in the heterozygous form, the mutation is NOT recessive. Sometimes polygenetic variability will do a good job of masking the subtlety, but it is still there. This goes back to the idea of 100% ID of het Pieds out of a random pool of say 100 snakes. What I would say is that they may not be immediately ID'd as het Pied, but they are more likely to at least be ID'd as DIFFERENT. I submit that if you put two Specters in a tub with 100 normals, not tell anyone what morph is in there and how many, the success rate of someone saying I found two Specters would be low, with the rate of saying they found two "different" snakes higher. And depending on the variability among the normals some folks would not find any anomalies. So in this case markers may or may not help, but does not really change the fact that (in this case) Specter is a visible inc-dom mutation, and the markers (however subtle) ARE there. The results for het Pied in the same scenario would likely be similar.
Look, it would be beyond awesome if we could map genomes and do a ton of truly scientific experiments to see what is happening, but no one is paying for that to happen.
What we do have is a combination of experience with the animals as well as personal education and reasoning capability. Between myself, Brant and Travis we have over 20 years of college and graduate level education in varying fields. And with Travis' actually being in genetics, that is a bonus. You may say "so what" and that is fine, but what is shows is that there are groups of folks who have learned over the years how to examine and formulate opinions based on the available information.
The available information at this point does not support the Pied mutation as being Simple Recessive, and does better support it being incomplete dominant.
-
Also, the concentration on the railroad tracks for het Pieds, and the fact that some normals have them is just not valid. Some normals have a banded pattern with little or no alien heads. Does this automatically cast out Genetic Banded? Some have broken up alien heads, does this cast out Genetic Granites? The same for singe alien heads and Mojaves, clean bellies and LOT of morphs etc...
Getting stuck on ONE marker is not the way to go about it. Polygenetics and, frankly, quality of the specimen have (as mentioned) a lot to do with it as well.
Does not change the fact het Pieds are a visual morph.
-
What are Pieds? (Jinx)
Besides train tracks what other indicators make JUST a het pied a morph on its own? I'm talking about on its own, not in another morph.
-
Re: What are Pieds? (Jinx)
Quote:
Originally Posted by youbeyouibei
Genome mapping. I'd gladly contribute to help fund that research project! Hands on experience is great but without specific parameters, test/control groups, a significant enough population to account for statistical anomalies, it's all just anecdotal "evidence" in the end. More likely than not doesn't meet the level of proof beyond a reasonable doubt. Interesting points to the discussion but at the end of the day it's just that, a discussion.
^ This ^!
And I wholeheartedly agree with the points you made (v below v) and the example you cited regarding the Russian foxes. Interesting discussion and I can see both sides of the discussion...or argument, whatever but I'm still on the fence.
Quote:
Originally Posted by bunnykit
HmmHmmHmm.... Reading through those ten pages hurt my brain. I won't comment on who's throwing stones in a house made of glass, but it pretty much covers everyone, most likely even myself.
Anyhow, I would be more interested in seeing a real gene test being done, not just on pied, het pied, albino and het albino, but on all kinds of morphs and on a large group of ball pythons.
People here talk about genes, but all we have to go on right now are visible changes, that can only be seen from the outside. Genes control EVERYTHING, outside in, personality, temperament, color, fertility etc.
As an example, in russia they have been breeding foxes for more then 50 fox generations, and the things they picked their breeding animals on was; How much did the animal like humans? They wanted to see, and prove out, how dogs had been breed from wolves and try out how fast you could achieve that.
For all those that starts to think this is unrelated, bear with me here.
They breed on temperament alone, but after a few generations, the 'kind' foxes started showing other traits, such as curled tails, floppy ears, new coloration's such as piebald, blaze, white socks etc. Their behavior changed, and they are now visible different from the 'wild' foxes.
So what is there to learn from this, and how is it relevant to this thread? My point is that just because some genes expresses color, and is related to color, that same gene controls more then just that simple color. Spider ball pythons tend to have the head wobble for example, because that gene controls more then just the withdrawal of color and pattern. It also controls things inside the animal.
Now, there are spiders with a 'bad' wobble, and spiders with almost no wobble, so there is a scale on how much the gene affect the animal. This change could be related to the other side of the genetic, since spiders are dom it means one gene on that pair, and for all we know the other gene might affect the wobble, or the combination or other genes from one or both or it's parents might. It might be random, it may not be.
Hets have one gene, just like spiders, and just like spiders they will show their gene and it's effect differently. Just like there are pattern and color variation within every morph, there will be differences in the hets too. In my eyes that is only logical.
Now I know there will be flames and fire because I just compared a dom to a het, but bear with me. What I want to compare is not (only) how much it shows or does not show, but rather how diffidently they may express themselves even within the same group. Also if you compare a spider to a het pied, then the het pied will in my eyes be a recessive and the spider without a doubt dom. There is a scale, and pied is inherited way more subtitle and invisible.
You guys keep obsessing over 'is it seen or is it not' and 'that means it is, it means it is not' but I don't think you see the big picture all together.
Genes control EVERYTHING, so if one gene is present, it might, and most likely will, affect more then just ONE thing.
Can het pieds have markers? Yes, they can. Is there a case, known cases, where there was NO markers? Yes, there have been. Where does that put us?
It is proven that markers is not a 100% way to identify a het, some morph hets are easier to identify because the color gene that causes the homogeneous form does have some more gene coverage than just that one thing, and thus it MIGHT, but is not GUARANTIED to affect other genes on different scales. Is it still a recessive? It is interesting to think about, and I think it is, but think about it like this;
Even though spider is not a het, I will use it for example once again (one of my fav colors, what can I say):
If a het pied have a ring, and a spider have a wobble, in the grand picture all that tells us is that the gene have more jobs than one or that the gene works together with other genes and creates a ripple effect. Can the one gene in a heterogeneous animal have any visible change and still be het? Yes, it can, in SOME cases, and in those cases it is based on what the OTHER genes are.
Don't forget the other genes.
The 'normal' genes and the 'pied' genes play together, and that is why I would love to see a real genetic analyse on several het pieds and similar morphs. Only then can you with certainly say you understand the GENES. I would love to see an gene analysis on a het pied with high markers, and one without any markers at all for example. I know the het pied gene would be there in both cases, but what about the other genes except that one/s? How do they play together?
As for the visual bit and the name for them....I liked the sound of 'expressed hets' - and I know at least one of you will spit fire and flames at the combo of those words since they do in fact contradict each other, but truth is that hets are not 100% certain to display any markers at all, and thus I don't consider it to be proven anything else than recessive.
In the case with markers the gene/s that was passed along played with the genes of the other part in the animal, causing some small, occasional visible changes, and some breeders that have seen many, many, many animals will have an easier time identifying a possible het, but this warning goes to ALL of you;
Until something is proven by more than your own experience overconfidence in your own ability will only do you harm, and close any paths in your mind to be open for new ideas.
Genes are not always simple. Genes can not always be understood completely by just looking at an animal, simply because we don't understand what the genes does exactly in the animal without a complete analysis, and I have yet to see any one here present such. One color morph have great variations, no matter what animal it is, and its only to be expected that hets may have variations too, this does not make them more or less het, but as with the other colors it may affect the end result in the animal, and what visual genes you can actually see in them.
....Yeah...I hope anyone understood where I'm coming from with this. Sorry for the long speech.
-
Re: What are Pieds? (Jinx)
Quote:
Originally Posted by Mike41793
Besides train tracks what other indicators make JUST a het pied a morph on its own? I'm talking about on its own, not in another morph.
You know, that is a great question. There is a lot of concentration on the railroad tracks, but I will tell you that many are ID'd in a clutch just because they are "different". Hopefully some one else who has a better working knowledge of this than I do will chime in here.
As for eliminating the morph as recessive, all that is needed is for the het Pied to be visually DIFFERENT from the non-het Pieds in the clutch. As brant mentioned, sometimes you really need to see a snake with its clutch mates to pull it out as different. IF you can do this it is NOT recessive.
Also, as stated before, the subtlety of the morph can make this difficult, especially if one is not looking for it.
-
Re: What are Pieds? (Jinx)
Quote:
Originally Posted by Royal Hijinx
You know, that is a great question. There is a lot of concentration on the railroad tracks, but I will tell you that many are ID'd in a clutch just because they are "different". Hopefully some one else who has a better working knowledge of this than I do will chime in here.
As for eliminating the morph as recessive, all that is needed is for the het Pied to be visually DIFFERENT from the non-het Pieds in the clutch. As brant mentioned, sometimes you really need to see a snake with its clutch mates to pull it out as different. IF you can do this it is NOT recessive.
Also, as stated before, the subtlety of the morph can make this difficult, especially if one is not looking for it.
You can't 'create' a morph or identifying one with just saying it's 'different' and that's all you got :/ For it to be labeled, or be re-labeled, you need to pull out some info on how to positively identify a het, WHAT makes it different, and understand WHY it is, and why some other hets are not. So far, even after eleven pages, no one knows what makes some hets have markers and some don't.
This kinda remind me of a friend who says that the coloration 'Tuxedo' in cats is a breed. All black and white cats. Because they look like each other.
From what I can see the het pied that looks 'different' look indeed 'different' even from other het pieds, and that's the problem. There is no way to classify them better than het pied, or possible het pied if you do not know the parents, breed them yourself, or have their siblings to compare with. Since you can't predict how different it will look, or predict IF it will have any markers at all, it is not a 'visible' gene morph on more than occasionally, and even in those cases it's not proven that it's not because of something else.
Every snake is different, every pattern differs if just a little. There are probably hundreds of variations on normals for example. If you take one of those, and match it with a normal that looks like it, you can create a morph if you're lucky and they carried some traits that were dominant, but you can't do the same with het pieds. You can't predict them, and you can't count on them having markers or count on them to affect any other morph in a specific way.
I think it's best to leave it the way it is actually :/ Because what have not been proven should not be re-named, just because some people think it should.
And 20 years experiance on three guys....that's on avarage what... 6.6 years per head? That's like 6-7 breeding seasons on average per person then. I'm sorry, but that's not all that impressive, I've seen 70 year olds that didn't know anything about anything they are doing - age and time spent on something does NOT guarantee that you have learned all you can learn and it does NOT guarantee that you can see, or do, something better than someone who have been doing the same for lesser amount of time.
I quote myself, just for you;
"Until something is proven by more than your own experience overconfidence in your own ability will only do you harm, and close any paths in your mind to be open for new ideas."
-
Ok... and my point about the 20 years merely had to do with the fact this idea is not coming from folks who do not have a proven track record of researching and making decisions. We would not hold the degrees we have without some level of proficiency at this. Does it make us better than anyone, of course not. You are looking for a point that was not being made.
Also, bunnykit, would you do us all the favor of formally introducing yourself in the introductions (i.e. not this thread). Fair to know who is calling us out, and actually a requirement of most internet forums. If I missed this intro I apologize in advance, but a search of your 11 posts did not show one.
Also, the fact that a het Pied can make a Pied DEFINES the morph, not the markers for picking one out. Simply, the fact that the visual outcome is changed in the het Pied form, eliminates it from being simple recessive. So we have a morph that makes Pieds that cannot be simple recessive...
Back to the original question. Is Pied a recessive trait? If not, what is it.
Answer: It appears that it is not recessive.
The "do not change it until you have scientific proof" argument is invalid. There is enough proof out there to say that Pied is most likely NOT recessive. This was the main point of my last set of posts, and really the crux of this thread.
This leaves is it Dom, Co-Dom or Inc-Dom?
It is NOT Dominant, that is obvious and agreed upon.
So far, there are NO co-dominant morphs in ball pythons.
So that leaves incomplete dominant. It fits this description well enough that there is zero need for new terms to describe it.
Incomplete Dom may not be the the absolute perfect answer (hard to find in science in general), but it is surely the BETTER answer. We should always be looking for the better answer.
-
Re: What are Pieds? (Jinx)
Quote:
Originally Posted by Royal Hijinx
Also, bunnykit, would you do us all the favor of formally introducing yourself in the introductions (i.e. not this thread). Fair to know who is calling us out, and actually a requirement of most internet forums. If I missed this intro I apologize in advance, but a search of your 11 posts did not show one.
The "do not change it until you have scientific proof" argument is invalid. There is enough proof out there to say that Pied is most likely NOT recessive. This was the main point of my last set of posts, and really the crux of this thread.
Incomplete Dom may not be the the absolute perfect answer (hard to find in science in general), but it is surely the BETTER answer. We should always be looking for the better answer.
I have another quote for you then, it suits you and us all in this thread very well in all aspects;
“We learn more by looking for the answer to a question and not finding it than we do from learning the answer itself.” - Lloyd Alexander
Also another thing that is interesting, and relate to my earlier post in this thread is that there was this famous racing horse, I can't remember his name atm, but he was red with a white blaze. They made clone foals from his dna, trying to see if they could re-create the famous race horse that was their 'original'.
This is not a made up story, google can probably help you find it.
Anyhow, they cloned the horse, they were 100% genetically identical to each other and their dad, however this is what caught MY eye;
The blaze in the foals foreheads were all different. Their genes were exactly the same, but they looked different.
With other words, it would, in theory be nothing genetically different going on in a visible het and one without markings, it's all within the range of possibilities.
That is why I am saying that genetics are way more complex than some people would like to believe. The end result affected by so many factors, I don't think we will ever map them all down.
And honestly no, I have not made an introduction, nor do I see the overwhelming need to make one. I'm here, we're talking, it's online. Knowing what country I'm from, my gender (although that one is not hard to guess), my age or other circumstances is only to please the curiosity of other people so that they think they know who you are, when in fact they do not. It would not benefit my purpose here, nor would it benefit our conversations.
But just because you asked so nicely, I can pull a small resume; I am called Bunnykit. I own a spider ball python. I breed animals and I train animals. I have worked with recessive traits before in most animals that I breed. I am not too good with the names of it all since english is not my native language, I only know that bit in my native tongue, but what I would question is not the genetics of the animals since this is yet to be proven properly, but rather the arrogance of people claiming to know all about it.
Can you prove your point properly? I say you can not. You have a good theory, there MIGHT be something that you and those other people are about to find out, but many of those have come and come undone before, so as for now it is just so; a theory.
Will a piebald be a piebald with two piebald genes? Yes, it will. Can you see a visual difference in all hets? No, you can not. This makes it score in as recessive as far as I can tell.
Only in SOME cases are there visual changes in the het offspring, and those cases have not been proven out to not have something else influencing the end result. To aim it down to one gene, or to try and simplify the pattern of relevance and the genetic ripple effect is not a good method of proving a theory.
Two genes working together can create something completely different, I do believe that butter/lesser, Mojave/Mojave, Mojave/lesser etc came up before. Those are different morphs that ends up with a completely different end result. And yes, before you start flaming about them being visible traits from the beginning, if that was your reaction you are missing my point. One gene can influence another, and yet paired up with something else have no effect. The ball pythons we have in captivity, and the morphs that have been created, some of them are bound to react to each other, even the recessive ones, since I do believe that some of them work with the same genes.
As I said, I think that "Expressed recessive" or "Randomly expressed recessive" but still "recessive" is good, because that's what it is. It's not hard to think that there might be different piebald variations, and that some in combinations with another set of genes will give some visual changes... but to pull the whole mutation over one edge and to try and re-label it just because it COULD be, because of something that you see in something you want to see it in.... I'm sorry but no.
Until there is a line with 100% visible het offspring I don't think any labels will change, because until then it is not expressed, it's repressed, hidden, in more cases than it is not.
-
As far as genetics goes and it's relation to ball python breeding, this is a hobby for most and profession for some. We have people in the hobby at many levels with a wide range of education and experience. A agree that an in depth scientific study to determine the nature of mutations would be the answer and help us define a proper labelling system. This is not realistic though. Too many morphs to study and who is going to invest the money for the research. The results of such research will not be quickly proven out either I assume. I am by no means an expert in genetics or ball pythons for that matter.
Personally I think the big issue is, we are using labels that many believe to be carved in stone or fit the scientific mould. This is not necessarily the case because morphs are proved out by many without scientific background. So the building blocks of our labelling of genetic traits is already a little shakey IMO. To say there hasn't been a mistake or mislabelled morph is lazy. I think this discussion (both sides of it) is fantastic. We are using these labels to help us with breeding projects and give those of us whom are not geneticists, a grasp on what is happening and expectations for breeding projects. It also play a part in marketing.
IMO most morphs are correct and this pied subject has arguments on both sides. I believe inc. Dom may prove better fit because there seems to be subtle and not so subtle visible differences in the het. I think if a handful of breeders did a breeding project to normals and documented the findings it could provide the proof that is required to satisfy the community. As it stands there is evidence that can't be ignored to warrant such a project to prove this out.
At the end if the day this is a challenging but healthy discussion and may inspire a project for breeders willing to sacrifice some time and resources. Genetics is a complex subject and has been perhaps oversimplified for the purposes of describing ball python morphs.
I think most has been said here but an objective breeding project among several breeders would help settle the debate.
-
Re: What are Pieds? (Jinx)
Quote:
Originally Posted by whispersinmyhead
As far as genetics goes and it's relation to ball python breeding, this is a hobby for most and profession for some. We have people in the hobby at many levels with a wide range of education and experience. A agree that an in depth scientific study to determine the nature of mutations would be the answer and help us define a proper labelling system. This is not realistic though. Too many morphs to study and who is going to invest the money for the research. The results of such research will not be quickly proven out either I assume. I am by no means an expert in genetics or ball pythons for that matter.
Personally I think the big issue is, we are using labels that many believe to be carved in stone or fit the scientific mould. This is not necessarily the case because morphs are proved out by many without scientific background. So the building blocks of our labelling of genetic traits is already a little shakey IMO. To say there hasn't been a mistake or mislabelled morph is lazy. I think this discussion (both sides of it) is fantastic. We are using these labels to help us with breeding projects and give those of us whom are not geneticists, a grasp on what is happening and expectations for breeding projects. It also play a part in marketing.
IMO most morphs are correct and this pied subject has arguments on both sides. I believe inc. Dom may prove better fit because there seems to be subtle and not so subtle visible differences in the het. I think if a handful of breeders did a breeding project to normals and documented the findings it could provide the proof that is required to satisfy the community. As it stands there is evidence that can't be ignored to warrant such a project to prove this out.
At the end if the day this is a challenging but healthy discussion and may inspire a project for breeders willing to sacrifice some time and resources. Genetics is a complex subject and has been perhaps oversimplified for the purposes of describing ball python morphs.
I think most has been said here but an objective breeding project among several breeders would help settle the debate.
Probably the most soothing text to read for this poor brain of mine all day long. Very well written, I thank you.
As it is I got in contact with a breeder just the week before this, he is hatching out some pieds very soon, three clutches, and is selling the ones with low-medium white for around 530usd, which I think is fair. I like the medium-low better than the high white, I want to see some color on there as well.
Planning on grabbing at least one male from him for a future project, for the heck of it I might pick up two normalls and try this out.
They would be 100% het, and I will get some normalls from my spider when he breeds too.
The pied thing would be in a year or two though, most likely two. Planing on getting a pretty little girlfriend for my spider for the upcoming season as well, a little butterfire lady that will hopefully gift me with a nuclear spider - my dream morph.
-
As far as this realting to who has the most paid for education and the most years in breeding, I may nit have as much as some people here, this does not make my knowledge any less relevant. I have been following ball pythons since the 90's. I remember when pieds were being sold for 50k. I have talked and do talk to the biggest breeders. People who have created the world firsts. I have owned ball pythons (pied hets being the very first) for several years and have been breeding them for 6. That does not give me the most experience, but I do have experience.
One gene can influence others. I have said this before. Normals can and do look other than normal. Does this make them other than normal? Loik at Brents prospects for example. He goes through thousands of animals. How many of those actually end up being anything but? I bet a large majority. Again if a couple het pieds are put in a group of 20 or 30 "unusual" normals, I bet you that they could not 100% correctly be pulled out.
These experts have also failed to answer my question. I can pull out our het lavs from possible het and het breedings. Does this make them non recessive?
So little is actually know about the ball python mutations. We can guess all we want. I can tell you as theory based on my knowledge that the homo pearl and the spider sable probably suffer from a leathal frame shift mutation. One that causes damage to an esential function of a protein. Spiders probably suffer from a damaged protein that affects the nervous sytem.
I am not saying that nothing can change. What I am saying is that just because you think your right that it has to be because you have a phd or you know more than everyone else. Why confuse everyone else with your thoughts? Why muddy things up more. Prove out your theory dont just rock the boat.
-
My opinion doesn't count for much: I am just a hobbyist who hopes to be a breeder who has taken AP Bio but has two biochemist parents and thus a lot of exposure to "sciency" stuff, but here it is:
My understanding of the Mendelian terms at use here is they are useful shorthands for phenomenon created by the presence or absence of a working copy of a given "gene". For instance, traditionally albinism is considered recessive, because it is a phenotype only shown when an individual has two copies of a non-working gene coding for melanin production or placement. If they have one working copy and one non working copy, in this case, the working copy serves just as well as having two working copies, so the heterozygotes cannot be distinguished and the trait is recessive.
For a dominant trait, instead it is a case having a single copy of the gene is enough to create a full phenotypic change. In this case the "gene" is usually a working protein that works different than a normal copy, if I am not mistaken, resulting in a different phenotype. In incomplete dominance, the effect of having two copies of the aberrant gene is more pronounced than having one copy.
All of this everyone should probably have some grasp of to be debating here, and it seems most do. Where it seems to be breaking down is what constitutes a true recessive versus an incomplete dominant. And that is part of the reason I went into detail above in to what it actually means at a molecular level: in all cases these genes are doing the same things, coding for proteins. There is no "marker" on a gene saying it is recessive or dominant, you can only judge by its effects in the animal.
My understanding is if it produces an effect in the animal as a heterozygote, it is dominant, codominant, or incomplete dominant. If it does not it is recessive. Period. If the heterozygotes are identical to homozygotes it is normal dominant. If they are an intergrade or otherwise different than the homozygites it is incomplete dominant. If there are multiple alleles all of which express as dominant on one locus they are codominant (probably no examples in BP, although honestly BEL complex genes sound like they may qualify - someone more knowledgabke than me should judge that).
So where does this leave het pied? Well, is het pied visually different than normals? Bunnykit and Tessedas seem to be saying either "No," or "I dunno" or "Not all the time." Travis and Brent are saying "Yes, but the difference is subtle. It is always there, but not always easy to tell."
I have no het pieds, and no experience with them. But I would say that if het pieds have actual, reliable phenotypic changes - even if those changes are very subtle, even if it takes an expert to suss them out, and even if some BP show those changes but aren't het pieds - then it is a inc dominant trait. BP are polygenic brings after all and you can't expect everyone to express every trait the same way every time, and the possibility of "false markers" is to be expected. It is hardly unbelievable that more than one gene might create train tracks or a ringer: more than one creates Axanthics, after all. But if het pied itself always brings about a set of changes which can be seen, then it is inc dominant, no matter how subtle.
If however het pieds don't show any consistent differences or changes, then it is recessive. But it seems to me pretty well established that pieds do have markers.
As far as being able to tell het lavenders, Tessedas, if that is true, well for one, congrats. And two, yes, if het lavs look different, then it too is a very subtle inc dominant trait. Without anyone else backing you up it might be hard to convince others, but hey, why bother? You can keep picking out your hets and go laughing all the way to the bank, confident in your knowledge the gene is influencing their phenotype when heterozygous and is thus by definition dominant.
-
Ok, I am washing my hands of this thread, as I have little patience for the unreasonable. :gj:
Maybe Brant or Travis will have more to say, maybe not.
To the OP, hopefully your questions was answered satisfactorily, or at least enough information was provided for you to make an educated decision.
-
Re: What are Pieds? (Jinx)
Quote:
Originally Posted by Theodore Tibbitts
My opinion doesn't count for much: I am just a hobbyist who hopes to be a breeder who has taken AP Bio but has two biochemist parents and thus a lot of exposure to "sciency" stuff, but here it is:
My understanding of the Mendelian terms at use here is they are useful shorthands for phenomenon created by the presence or absence of a working copy of a given "gene". For instance, traditionally albinism is considered recessive, because it is a phenotype only shown when an individual has two copies of a non-working gene coding for melanin production or placement. If they have one working copy and one non working copy, in this case, the working copy serves just as well as having two working copies, so the heterozygotes cannot be distinguished and the trait is recessive.
For a dominant trait, instead it is a case having a single copy of the gene is enough to create a full phenotypic change. In this case the "gene" is usually a working protein that works different than a normal copy, if I am not mistaken, resulting in a different phenotype. In incomplete dominance, the effect of having two copies of the aberrant gene is more pronounced than having one copy.
All of this everyone should probably have some grasp of to be debating here, and it seems most do. Where it seems to be breaking down is what constitutes a true recessive versus an incomplete dominant. And that is part of the reason I went into detail above in to what it actually means at a molecular level: in all cases these genes are doing the same things, coding for proteins. There is no "marker" on a gene saying it is recessive or dominant, you can only judge by its effects in the animal.
My understanding is if it produces an effect in the animal as a heterozygote, it is dominant, codominant, or incomplete dominant. If it does not it is recessive. Period. If the heterozygotes are identical to homozygotes it is normal dominant. If they are an intergrade or otherwise different than the homozygites it is incomplete dominant. If there are multiple alleles all of which express as dominant on one locus they are codominant (probably no examples in BP, although honestly BEL complex genes sound like they may qualify - someone more knowledgabke than me should judge that).
So where does this leave het pied? (snip)
I've never bred ball pythons, but I've bred other snakes and assisted with mice, ringneck doves and pigeons when I worked in my university's genetics lab.
"My understanding is if it produces an effect in the animal as a heterozygote, it is dominant, codominant, or incomplete dominant. If it does not it is recessive. Period. If the heterozygotes are identical to homozygotes it is normal dominant." That is a pretty good understanding.
"If they are an intergrade or otherwise different than the homozygites it is incomplete dominant. If there are multiple alleles all of which express as dominant on one locus they are codominant (probably no examples in BP, although honestly BEL complex genes sound like they may qualify - someone more knowledgabke than me should judge that)." This part is off.
Different textbooks have different definitions for incomplete dominant, codominant, overdominant, semidominant, partial dominant, and other terms for genes that are not fully dominant or fully recessive. As far as a breeder is concerned, all of them can by lumped together as synonyms for simplicity -- if they are an intergrade or otherwise different than the homozygites it is incomplete dominant (= codominant = partial dominant = semidominant = etc.). For what it's worth, the prof I worked for used codominant because it had the fewest characters to write. Semidominant is almost as short.
From the pictures of homozygotes and heterozygotes I have seen, both lesser platinum mutant gene and the mojave mutant gene are codominant to the corresponding normal gene.
Codominance can be hard to prove. IMO, if someone inexperienced can pull out 95% of the heterozygotes from a bin containing all three genotypes, then the gene is codominant. But that requires listing the phenotypes of all three genotypes and keeping breeding records. How subtle are the differrences and how reliable are those phenotypes for identifying genotypes? In other words, beat the nay-sayers to death with data. I haven't seen such data. Till then I lean towards keeping pied classified as a recessive.
-
Regarding markers. I personally think there are good and bad examples of 'hets' (specifically when regarding pied and clown) like any other WT or morph.
I posted a picture of normal het clowns previously. You can definitely see the clown gene influencing the normal phenotype.
A few are more obvious than others. I consider this equivalent to the example of Yellowbelly or Fire. Some people cannot distinguish a horrible example of a YB or Fire from a normal. But good examples stand out and pop.
These 2 morphs can be subtle alone, but do big things when combined with morphs. Same thing with these "hets". It's not that the markers or whatever traits aren't there. They are there. Just more downplayed and subtle compared to the better examples of it....
Just my $.02
-
Re: What are Pieds? (Jinx)
Quote:
Originally Posted by Theodore Tibbitts
So where does this leave het pied? Well, is het pied visually different than normals? Bunnykit and Tessedas seem to be saying either "No," or "I dunno" or "Not all the time." Travis and Brent are saying "Yes, but the difference is subtle. It is always there, but not always easy to tell."
I have no het pieds, and no experience with them. But I would say that if het pieds have actual, reliable phenotypic changes - even if those changes are very subtle, even if it takes an expert to suss them out, and even if some BP show those changes but aren't het pieds - then it is a inc dominant trait. BP are polygenic brings after all and you can't expect everyone to express every trait the same way every time, and the possibility of "false markers" is to be expected. It is hardly unbelievable that more than one gene might create train tracks or a ringer: more than one creates Axanthics, after all. But if het pied itself always brings about a set of changes which can be seen, then it is inc dominant, no matter how subtle.
If however het pieds don't show any consistent differences or changes, then it is recessive. But it seems to me pretty well established that pieds do have markers.
As far as being able to tell het lavenders, Tessedas, if that is true, well for one, congrats. And two, yes, if het lavs look different, then it too is a very subtle inc dominant trait. Without anyone else backing you up it might be hard to convince others, but hey, why bother? You can keep picking out your hets and go laughing all the way to the bank, confident in your knowledge the gene is influencing their phenotype when heterozygous and is thus by definition dominant.
That is where the problem is. All recessive ball pythons have het "markers" all of them. Everyone who breeds recessives can pretty confidently pick out their het hatchlings... so either these recessives are either recessive or they are not. It's not restricted to just pieds.
-
So they aren't, then. What's the problem?
-
What are Pieds? (Jinx)
Quote:
Originally Posted by Royal Hijinx
Ok, I am washing my hands of this thread, as I have little patience for the unreasonable. :gj:
Maybe Brant or Travis will have more to say, maybe not.
To the OP, hopefully your questions was answered satisfactorily, or at least enough information was provided for you to make an educated decision.
I may or may not have already had my own opinion made up before i even started this thread, or before i even asked you in that other thread... I may or may not have had any questions at all and just wanted to start a debate to see what others thought about it... ;)
I've really enjoyed this thread though! Good job jerry! :gj: :rofl:
-
What are Pieds? (Jinx)
Quote:
Originally Posted by satomi325
Regarding markers. I personally think there are good and bad examples of 'hets' (specifically when regarding pied and clown) like any other WT or morph.
I posted a picture of normal het clowns previously. You can definitely see the clown gene influencing the normal phenotype.
A few are more obvious than others. I consider this equivalent to the example of Yellowbelly or Fire. Some people cannot distinguish a horrible example of a YB or Fire from a normal. But good examples stand out and pop.
These 2 morphs can be subtle alone, but do big things when combined with morphs. Same thing with these "hets". It's not that the markers or whatever traits aren't there. They are there. Just more downplayed and subtle compared to the better examples of it....
Just my $.02
I agree with this 100%. There are high quality het pieds and not as high quality het pieds, imo.
To illustrate nikkis point, there are higher quality fires:
http://img.tapatalk.com/d/13/05/23/mygu2yze.jpg
And fires that look more like normals (google image):
http://img.tapatalk.com/d/13/05/23/zydaju9a.jpg
And higher quality YB's:
http://img.tapatalk.com/d/13/05/23/eduzu2aq.jpg
http://img.tapatalk.com/d/13/05/23/e7u6ezej.jpg
And YB's that look more like normals (google image):
http://img.tapatalk.com/d/13/05/23/u3etabuh.jpg
I smell what you're cooking nikki. ;)
-
Re: What are Pieds? (Jinx)
Quote:
Originally Posted by TessadasExotics
That is where the problem is. All recessive ball pythons have het "markers" all of them. Everyone who breeds recessives can pretty confidently pick out their het hatchlings... so either these recessives are either recessive or they are not. It's not restricted to just pieds.
Wait... did you just argue against the point you've been arguing...?
-
Tessadas - One thing that I've noticed you saying repeatedly is that het snakes don't look like there homozygous counterparts within a givin gene. This is true, but it still doesn't make them recessive. Cinnamons don't look like super cinnies, lemonbacks don't look like BlkELs, mojos don't look like BELs, etc. Does this make them recessive? Absolutely not! You have said yourself that you believe a mutation to be recessive if a heterozygote doesn't differ from the WT homozygote in terms of morphology. You also said that you can pick out your het lavender albinos from non-hets BASED ON APPEARANCE (not yelling, just emphasizing - I don't yell on the internet.) while, at the same time, saying that the mutation is simple recessive. Do you really not see how that is you contradicting yourself?
I have loved this thread! Gaining knowledge through questioning accepted norms that haven't actually been proven always get me excited. I've gotten some feelings reading this thread that have reminded me of when I rejected belief in a god and opened my eyes to what I believe is reality. Just like then, there are those here now that still insist on charging ahead blindy with what they already know and I will never understand why. What is so bad about finding out that you were wrong about something, especially in a case like this where you are far from alone in your beliefs? Is it not better to learn that you were wrong and in the process learn the truth than to go on being wrong for the rest of your life? I really am dumbfounded by some of the close minded things that have been said thus far here.
-
What are Pieds? (Jinx)
What is pied?
Baby don't hurt me,
Don't hurt me,
No more.
-
So recessives are co dom, and het reds are recessive and every dinker has its day i guess.....
-
Quote:
Originally Posted by Royal Hijinx
Ok, I am washing my hands of this thread, as I have little patience for the unreasonable. :gj:
Maybe Brant or Travis will have more to say, maybe not.
Nope, after this post I am done. I have tried, lord knows I have tried. And I think the people who were actually interested in learning something have gotten all they need to know out of this. So I am not going to stay around and be falsely accused of being a horrific source of misinformation and told that I making the hobby worse by someone who is being purposefully obtuse and wantonly obfuscating. That and I am tired of the cries of foul over things that are not even imaginably insulting coming from the mouth of someone who is blatantly being petty, spiteful, vindictive, malicious, snarky and petulant.
Quote:
Originally Posted by TessadasExotics
I do understand genetics and my knowledge is not that limited. Despite what you may feel.
Now by your example/interpritation of why a pied is not recessive..... I can pick out our het lavs and our het hypos from our hatchlings. Does this make them non recessive? How about people who can pick out their het albinos? Im sorry but just because a pied allele can slightly influence the het snake WT allele does not rule it out as not a recessive trait. Another example. And understand I am not talking about added mutations I am talking WT. Many WT show the het pied markers yet they are in fact not het pied. That being said if I took 1 or 2 hetppieds and put them with 20 WT snakes, do you honestly think that you can positively identify those 1 or 2 het pieds from out of the group? I think not. Sorry but I dont buy it.[/QUOTE]
As Jinx so susinctly pointed out:
Quote:
Originally Posted by Royal Hijinx
The key to a subtle mutation is that while you may not be able to pinpoint EXACTLY what is off (as far as ID of the morph) but you surely be able to see the SOMETHING is different from the normal appearance. IF you can SEE this difference in the heterozygous form, the mutation is NOT recessive. Sometimes polygenetic variability will do a good job of masking the subtlety, but it is still there. This goes back to the idea of 100% ID of het Pieds out of a random pool of say 100 snakes. What I would say is that they may not be immediately ID'd as het Pied, but they are more likely to at least be ID'd as DIFFERENT. I submit that if you put two Specters in a tub with 100 normals, not tell anyone what morph is in there and how many, the success rate of someone saying I found two Specters would be low, with the rate of saying they found two "different" snakes higher. And depending on the variability among the normals some folks would not find any anomalies. So in this case markers may or may not help, but does not really change the fact that (in this case) Specter is a visible inc-dom mutation, and the markers (however subtle) ARE there. The results for het Pied in the same scenario would likely be similar.
Let me extend that analogy to answer your ridiculous contention that because you can pick out every het know under the sun that means that there is no such thing as a recessive anything.
1) If I take 990 WT animals and throw in 10 Lessers, could you pick those out?
2) If I take 990 WT animals and throw in 10 Huffman, could you pick those out?
3) If I take 990 WT animals and throw in 10 Leopard, could you pick those out?
4) If I take 990 WT animals and throw in 10 Specters, could you pick those?
5) If I take 990 WT animals and throw in 10 Paints, could you pick those out?
6) If I take 990 WT animals and throw in 10 het BlackLace, could you pick those out?
7) If I take 990 WT animals and throw in 10 het Lav, could you pick those out and?
8) If I take 990 WT animals and throw in 10 het Albino, could you pick those hem?
9) If I take 990 WT animals and throw in 10 Pied, could you pick those out and?
I already know that your answer to 1-6 would be “Yes” because they are all inc-dom according to convention. And you would say “No” to 7-9 because convention has held that those are all recessive.
Now, let me repeat the scenarios but ask the question thusly: could you pick those out ten animal, and only those ten animals and no others and absolutely identify them? If you said “yes” to anything other than 1) then you are a liar plain and simple.
Oh, I am sure you could pull Huffman-like and Leopard-like and Specter-like and Paint-like animals. But if I limited you to only pulling ten animals then you would undoubtedly fail to pull all ten of what I put in there simply because there are some aberrant WT that have phenotypes similar enough to all of those and yet are not stably heritable and you would inadvertently pull one of those instead of the true morph. And yet all of those are considered inc-dom… How do you justify that? According to you we ought to re-label all of them recessive because there are enough WT that look like them out there that you can never really know if it is the mutation or just all the other genes in the animal at play.
And now I will ask the same question one more time but put it to Jinx’s criteria. I take 990 WT and mix in 10 whatever. And now I will let you pull any animals you want that are “different”. Under those criteria, I would put good odds that someone with a trained eye could get animals that fit the criteria 2-6 and 9 but no one would be able to get 7 or 8, regardless of how good their eye was. Add another layer to it. Now you can breed whatever animals you pull but only to WTs. If you are dealing with animals that really are 2-6 and 9 you will see a heritability pattern when you breed them out but again, with 7 and 8, you certainly will not see heritability.
Now, the second layer of argument against your terminal logic flaw on how you can pick out het whatevers that you are blatantly ignoring; If I give someone, without telling them what they are, a WT and het Pied animal and breed them to a WT, I can look at the clutches and see that in one of the clutches there are animals that are markedly different, those are the het Pieds. And then I can take those and breed them to a WT and pick out the het Pieds. And then I can take those and breed them to a WT and pick out the het Pieds, ad infinitum. If I do the same thing, hand someone a WT and a het Lav/Hypo/Albino/whatever without telling them what the animals are and have them breed to WT then when you look at the clutches, you CANNOT see offspring that are markedly different. And you cannot therefore repeat the process on and on like you can with other inc-doms. This same thing holds true for the occasional WT that has similar “markers,” you can try breeding those out but with them the “marker” will not be consistently heritable in the same way as the het Pied traits are.
No that it will make a lick of difference to you but there are two reasons why your argument fails: 1) You could never potentially pull a het Lav or het Hypo or het Albino just by looking for “atypical” animals and 2) when you start with a het you will not see a heritability patter when breeding to WT. It is possible to do that with an inc-dom type mutation. Granted, if you are pulling from a thousand animals you might pull an animal that looks like it is carrying the Pied gene that does not prove out. But that exact same argument applies to EVERY other inc-dom morph as well.
Quote:
Originally Posted by Coopers Constrictors
..... Anyways .....
Travis and Brant have some damn good experience and knowledge in this stuff and I can't wait to see what comes out in the next few years. Having personally met Brant, and purchased a few of his Prospects, the guy has an eye for things... and a damn good eye at that... Travis is just, well, a Freaking genius at this stuff... and a darn good mentor... whether he knows it or not. This exact topic is what brings a lot of people into this 'lifestyle', per say, because of the interesting things that happens to these creatures and mysterious genetics behind it all.
Rock on guys.
Thank you Jerry. I greatly appreciate that :gj:
Quote:
Originally Posted by bunnykit
"Until something is proven by more than your own experience overconfidence in your own ability will only do you harm, and close any paths in your mind to be open for new ideas."
This is proven by more than one persons experience and it has nothing to do with overconfidence. There is absolutely no harm in people having discussions. Pigheaded obstinance for no sake other than to be contrary… that is a whole other matter.
Quote:
Originally Posted by bunnykit
And 20 years experiance on three guys....that's on avarage what... 6.6 years per head? That's like 6-7 breeding seasons on average per person then. I'm sorry, but that's not all that impressive, I've seen 70 year olds that didn't know anything about anything they are doing - age and time spent on something does NOT guarantee that you have learned all you can learn and it does NOT guarantee that you can see, or do, something better than someone who have been doing the same for lesser amount of time.
If you want to say that what I have done with my life and my education is worthless then go right ahead. To be frank, I could give a rip what you think. I am proud of my accomplishments and I do not need your approval nor do I particularly care what you think of me.
Also, I have already admitted that I do not know everything. And when I do not know something I take the time to try and learn what others have to teach me. The same way that some people have taken the time to try and learn what I have had to teach them. I have yet to see you (or Tessa for that matter) admit that maybe you might be able to learn something new.
Quote:
Originally Posted by bunnykit
I have another quote for you then, it suits you and us all in this thread very well in all aspects;
“We learn more by looking for the answer to a question and not finding it than we do from learning the answer itself.” - Lloyd Alexander
I can quote famous people all day long too. It does not make you smart… In fact, it kind of makes you look like you are not capable of original thought, but maybe that is just me…
Quote:
Originally Posted by bunnykit
Also another thing that is interesting, and relate to my earlier post in this thread is that there was this famous racing horse, I can't remember his name atm, but he was red with a white blaze. They made clone foals from his dna, trying to see if they could re-create the famous race horse that was their 'original'.
This is not a made up story, google can probably help you find it.
Anyhow, they cloned the horse, they were 100% genetically identical to each other and their dad, however this is what caught MY eye;
The blaze in the foals foreheads were all different. Their genes were exactly the same, but they looked different.
With other words, it would, in theory be nothing genetically different going on in a visible het and one without markings, it's all within the range of possibilities.
That is why I am saying that genetics are way more complex than some people would like to believe. The end result affected by so many factors, I don't think we will ever map them all down.
Why are identical twins not really identical?
I can answer this for you but would you really care? Obviously not because you have already made up your mind that you know all there is to know on the topic and that I would just be getting off on my overvalued education.
Oh, and just for the record, this example is actually moot because the cloning process, as it stands, is by no means tried, true or stable and it certainly is not perfect. As such, none of the clones are “perfect” copies of their father.
Quote:
Originally Posted by TessadasExotics
We can guess all we want. I can tell you as theory based on my knowledge that the homo pearl and the spider sable probably suffer from a leathal frame shift mutation. One that causes damage to an esential function of a protein. Spiders probably suffer from a damaged protein that affects the nervous sytem.
Citing one of the most common form of genetic mutations as “the” cause is not that original. I can toss out theories all day long too, education notwithstanding I can just open up a high school textbook.
Actually, the mutation is caused by a premature stop codon.
Or maybe it is siRNA…
Or maybe a TR binding site mutation…
How about a destabilized PE…
Just throwing out terms with nothing to back it up is worthless
Quote:
Originally Posted by TessadasExotics
I am not saying that nothing can change. What I am saying is that just because you think your right that it has to be because you have a phd or you know more than everyone else. Why confuse everyone else with your thoughts? Why muddy things up more. Prove out your theory dont just rock the boat.
Well since it seems that you have decided for the entire world that us talking about our theory “muddies the water” I guess we all ought to just shut up. I am glad to know that you are here to protect everyone by telling them that Brant and Jinx and I are just too dumb to have any ideas that ought to be talked about because they go contrary to decades of complacent acceptance. I will remember that in the future; whatever was said is set in stone and do not talk about anything contrary to that because it just muddies the water.
Quote:
Originally Posted by paulh
Different textbooks have different definitions for incomplete dominant, codominant, overdominant, semidominant, partial dominant, and other terms for genes that are not fully dominant or fully recessive. As far as a breeder is concerned, all of them can by lumped together as synonyms for simplicity -- if they are an intergrade or otherwise different than the homozygites it is incomplete dominant (= codominant = partial dominant = semidominant = etc.). For what it's worth, the prof I worked for used codominant because it had the fewest characters to write. Semidominant is almost as short.
From the pictures of homozygotes and heterozygotes I have seen, both lesser platinum mutant gene and the mojave mutant gene are codominant to the corresponding normal gene.
Codominance can be hard to prove. IMO, if someone inexperienced can pull out 95% of the heterozygotes from a bin containing all three genotypes, then the gene is codominant. But that requires listing the phenotypes of all three genotypes and keeping breeding records. How subtle are the differrences and how reliable are those phenotypes for identifying genotypes? In other words, beat the nay-sayers to death with data. I haven't seen such data. Till then I lean towards keeping pied classified as a recessive.
Paul,
Most textbooks have fallen into a poor example of co-dominance, that being the red/white flower analogy. This is not co-dominance but incomplete dominance. Co-dominance and incomplete dominance are two separate things and not terms that can be used interchangeably.
I really do not have it in me right now to go in to the nitty gritty details but in a nutshell co-dom is a relationship that can only occur between two independently dominant alleles. Like the A and B blood types: A is dominant, B is dominant. Neither A nor B alone are co-dominant, they are only co-dominant with relation to each other. As such, no morphs in the hobby are known to be co-dominant.
-
Re: What are Pieds? (Jinx)
Correct me if I am wrong, but the correct definition of recessive and incomplete dominate genes are:
Recessive – Visually different from the wild type when in the homozygous form only. The heterozygous form is visually indistinguishable from the wild type
Incomplete Dominate – Visually different from the wild type when in the heterozygous form and visually different from the wild type and the heterozygous form when in the homozygous form.
So what seems to be in question is “What identification rate?” and by “How experienced of an eye?” defines the difference between a recessive gene and an incomplete dominate gene.
In our hobby, we currently have genes that are extremely subtle and difficult to identify in the heterozygous form that we consider to be incomplete dominate genes. A few that come to mind are Paint, Sentinel, Gravel, Specter, and Spark. These genes can be very difficult for experienced breeders/collectors to properly identify. The fact that wild caught and captive hatch animals showing markers for these genes are sold at a lower price tells us how hard it can be to identify these genes in their heterozygous form. This error/risk does not lead us to classify them as recessive.
As for wild type displaying “markers” of a gene, we could look at Granite for this. Some animals displaying a Granite pattern or “markers” prove to be dominate, incomplete dominate, or not even genetic. The fact that some of the animals displaying this gene’s makers prove to be non-genetic does not change the fact that some of the animals displaying the “markers” are genetic, even dominate or incomplete dominate.
This brings us back to the original question, is the Piebald gene recessive or incomplete dominate. I don’t have enough experience to answer that, but based on what I have been reading (here and other resources) and my own observations of the Hypo gene, I think there is a real possibility that some of our classically labeled recessive genes may actually be very subtle incomplete dominate genes.
I think that this thread has been good. It is always good to question the status quo (in a respectful manner), for that is how we strengthen our understanding or correct errors in our understating. Asking “Why do I believe what I believe?” and “Have any new facts come to light that should change what I believe?” are good and important questions because they cause our beliefs to become stronger or to be corrected.
Looks like Travis basically posted the same thing while I was typing up my thoughts.
-
The question here becomes where to draw the line. I like the idea of having recessive being a strict rule where you cannot tell the het from a WT. if you can it is not recessive. Incomplete dominant is a better fit for catching some of the grey area.
Side note: (since theories can be thrown around) I see miney as being a motivating factor for those unwilling to even think about letting go of the current paradigm with regards to recessive morphs. A recessive earns more money because you can sell hets and poss. Hets where the possible hets give you more money than a normal. For those whom are not honest this can be a big money maker. Especially if they can pick out hets and keep them for themselves. I like to think most breeders are honest and on this for the love of the animals. Human nature dictates there will always be a few. I by no means accusing anyone here of such actions but I could definitely this as a speed bump to progress. The other major speed bump is many people's natural resistance to change.
Personally I have already stared to think based in the experienced breeders, that can pick out her pieds, i see there a fairly reliable visual ID, and therefore it should be labelled inc. dominant like other subtle inc. dominant genes (Spector). Now if the argument is made that it is difficult to ID reliably and as such recessive. Then we should be changing a good number of incomplete dominant a as well. I couldn't pick out a Spector if my life depended on it right now. My skill eye is not that trained. That doesn't mean I won't be able to next year. I may also be able to pick out get pieds and such too.
I think at this point in time this thread served its purpose. I have found it a great learning experience and it has challenged me to think hard about BP genes. Like I have said I am still very new to snakes and ball pythons. I really value discussions like this even if I am not interested in the morph. (Probably the only one that doesn't really enjoy pieds). I would love to see some breeders with different sources if pied, do some tracking on breeding these to normals and post the results in a few years. I think it is a worthy project. More hard data is needed IMO to make this strong theory proven.
Thank you so much everyone for this discussion. It has been. A great read.
-
I was not going to comment further but Jim makes a wonderful point I want to address: poss hets
I have heard the following three statements (or some derivatoin therein) from more than a few breeders, big and small. Some of these were said, to my face, while I was vending at shows
1) I love poss het Pieds because when I breed my het Pied to het Pied I can tell which of the offspring are hets and hold them back but still sell the ones I know are normal as 66% and make some extra on them.
2) I hate that I am having to sell this animal as a 66% because I know by looking at it that it is a het Pied. But because it came from a pair of hets I have to label it that way because people do not realize you can pic het Pieds and when you try to explain it to them then they think you are just trying to gouge them for more money.
3) I just quite selling poss het Pieds as poss hets. I can pick the het Pieds easy enough and if I make a mistake it is going to be that I miss a het and sell it as a normal and so someone gets a bonus. But I have never pulled an animal that I was sure was a het Pied and been wrong.
If there are breeders, big name breeders, saying these things then maybe, just maybe, we peons ought to be listening.
-
Atgagtataagaaacataacctggataacatggataacgcatacccatgagccacacgattaaatgagcatcggccatac ccttgagtcatcggccaacgacgacgaggcgttctag
-
What are Pieds? (Jinx)
Quote:
Originally Posted by TessadasExotics
Atgagtataagaaacataacctggataacatggataacgcatacccatgagccacacgattaaatgagcatcggccatac ccttgagtcatcggccaacgacgacgaggcgttctag
Is that the pied DNA sequence? Lol
I mean immaturity is funny but come on.
-
Atgagtataagaaacataacctggataacatggataacgcatacccatgagccacacgattaaatgagcatcggccatac ccttgagtcatcggccaacgacgacgaggcgttctag
Translates to
Begin: SIR NIT WIT WITH THE PHD. Begin: SIGHTLESS AND DEAF.
I stand by my above statement: blatantly petty, spiteful, vindictive, malicious, snarky and petulant
-
Well, I think Tessedas can be dismissed as just trolling at this point.
-
Re: What are Pieds? (Jinx)
Quote:
Originally Posted by asplundii
Atgagtataagaaacataacctggataacatggataacgcatacccatgagccacacgattaaatgagcatcggccatac ccttgagtcatcggccaacgacgacgaggcgttctag
Translates to
Begin: SIR NIT WIT WITH THE PHD. Begin: SIGHTLESS AND DEAF.
I stand by my above statement: blatantly petty, spiteful, vindictive, malicious, snarky and petulant
Wow, really? If it was meant to be some kind of joke, not terribly funny...
Out of curiosity is there an online translator for this sort of thing?
-
If mine made no sense please forgive me.. I went 24 hours trying to quit smoking cold turkey... I have since smoked 4 cigarettes then and i like turtles
-
Re: What are Pieds? (Jinx)
Quote:
Originally Posted by Royal Hijinx
Wow, really? If it was meant to be some kind of joke, not terribly funny...
Out of curiosity is there an online translator for this sort of thing?
Haven't found a translator, but this will help if you've got time:
http://www.ncbi.nlm.nih.gov/staff/ta...ettercode.html
-
To go from DNA to Protein:
http://bioinformatics.picr.man.ac.uk...converter.html
To go from Protein to DNA:
http://www.gregthatcher.com/Bioinfor...Translate.aspx
Small note: For those not familiar with the genomic "alphabet", the letter M pulls double duty. If it is found at the beginning of a sequence it means "Begin". If it is found within a sequence it is simply M
-
Re: What are Pieds? (Jinx)
Quote:
Asplundii wrote:
Paul,
Most textbooks have fallen into a poor example of co-dominance, that being the red/white flower analogy. This is not co-dominance but incomplete dominance. Co-dominance and incomplete dominance are two separate things and not terms that can be used interchangeably.
I really do not have it in me right now to go in to the nitty gritty details but in a nutshell co-dom is a relationship that can only occur between two independently dominant alleles. Like the A and B blood types: A is dominant, B is dominant. Neither A nor B alone are co-dominant, they are only co-dominant with relation to each other. As such, no morphs in the hobby are known to be co-dominant.
I agree with the first paragraph with one exception. Codominance and incomplete dominance are two separate things biochemically. I specified that AS FAR AS THE BREEDER IS CONCERNED, they can be lumped together. This is because the breeding patterns are the same. And often the biochemists have not determined which a particular mutant is, leaving the breeder unable to classify a mutant gene specifically.
We disagree on the definition of codominance.
As far as I can tell, the biochemists define codominance as having one phenotype for each of the AA, Aa, and aa genotypes. And both genes produce functional products.
The biochemists define incomplete dominance as having one phenotype for each of the AA, Aa, and aa genotypes. And only one gene produces a functional product.
The A and B human blood types are among the oldest codominant mutants. But they are two genes in a three gene set. A is dominant to O, and B is dominant to O. Those are irrelevant to classifying A as codominant to B. Only two genes are compared when classifying one as dominant, recessive or codominant (incomplete dominant, overdominant, etc.) to the other. Changing one of the genes can change the classification. A is dominant to O. A is codominant to B. Changing O to B changes the classification of A.
There are biochemically codominant (not incomplete dominant) mutant genes that are recessive to the corresponding wild type gene. Siamese, Burmese and normal in cats, for example.
The mutant gene for sickle cell trait is biochemically codominant (not incomplete dominant) to the corresponding normal gene.
-
Re: What are Pieds? (Jinx)
Quote:
Originally Posted by Coopers Constrictors
Huh? Any and all Hets have the possibility to do weird things to other mutations, but that is all...
Leopards are IN FACT allelic with Piebalds. Therefore, all Leopards are basically Het Pied.
Pieds and Clowns are recessive... Period. I don't know why people are misinterpreting and over thinking proven information that has been around for decades now. Just because they may have the ability to have 'markers' and 'clean things up a bit' DOES NOT make them "codom" (btw... the proper term is Incomplete-Dominant, not codom)
I second the below text...
Well I would just like to say that incomplete dominance is the dominant allele incompletely dominating the recessive allele to create a blending effect. If the pied is considered a codominant, then it's not incomplete dominant because it possesses the dominant allele. That is codominance not incomplete dominance, but it's a common belief.
-
Quote:
Coopers Constrictors
Pieds and Clowns are recessive... Period. I don't know why people are misinterpreting and over thinking proven information that has been around for decades now.
Proven by who?
How dare anyone challenge the status quote :O
Quote:
Just because they may have the ability to have 'markers' and 'clean things up a bit' DOES NOT make them "codom" (btw... the proper term is Incomplete-Dominant, not codom)
It's not the ability to have them, they all show them no different than a yellowbelly, or spark, or paint shows their markers reliably.
I can't attest to pieds but het clowns are all visual, If you produce enough of them it becomes quite obvious.
-
Re: What are Pieds? (Jinx)
Quote:
Originally Posted by MorphMaster
Well I would just like to say that incomplete dominance is the dominant allele incompletely dominating the recessive allele to create a blending effect. If the pied is considered a codominant, then it's not incomplete dominant because it possesses the dominant allele. That is codominance not incomplete dominance, but it's a common belief.
Here's the problem with the above definition: which allele is dominant and which is recessive? A better definition is two alleles that produce a blending effect in the phenotype. That is shorter and avoids the problem.
Actually, for breeders, codominance and incomplete dominance are synonyms. I prefer "codominance" simply because it has 11 letters to type. "Incomplete dominance" has 20.
-
Re: What are Pieds? (Jinx)
Again, im no geneticist but is there such a thing as "incomplete recessive"? Just curious...
Sent from my H866C using Tapatalk 2
-
Re: What are Pieds? (Jinx)
Also, someone....has still not shown how you can tell albino hets from normals for me.
Sent from my H866C using Tapatalk 2
-
Re: What are Pieds? (Jinx)
Quote:
Originally Posted by 4theSNAKElady
Also, someone....has still not shown how you can tell albino hets from normals for me.
I have shown at least one example of their markers somewhere on bp.net.
Het albino is not visual enough for me to look at an unknown snake and say "that's a het albino" with any certainty, but in a clutch situation I have no doubt I could pull out real hets from non hets.
-
Here Jerry. Page 3 on the following link has some pictures of het albino markers.
http://ball-pythons.net/forums/showt...-markers/page3
-
Re: What are Pieds? (Jinx)
Its good info, but i still dont believe its that useful, because unless ur looking at a whole clutch for comparison and know EXACTLY what to look for, those het albinos look to me just like any other normal. I wouldnt ever take a chance on a het albino based on those "markers". Plus, the "marker" is soooo subtle, that youd have a zillion newbs questioning whether or not their normals are het albinos....almost the same thing with YBs. IMO, its way more confusing than helpful. When it comes to albino genes, id rather just plain ol get an albino, or the document guaranteeing the genetics.
Sent from my H866C using Tapatalk 2
-
I just posted that for Jerry. I don't know if those are clutchmates. I will have several clutches hatching out this season where I will be able to show clutchmates...but that is still a few months away ;)
-
First girl ovulated about a week ago
Het Albino female bred to pastave het hypo, stinger het hypo, and albino pinstripe
I have three other Het Albino females that have been breeding to my albino pinstripe. I'll keep you updated and try to get you pictures.
-
Re: What are Pieds? (Jinx)
Thanks Charlene! We all know on here useful info is HELPFUL info! :D
-
Quote:
Its good info, but i still dont believe its that useful, because unless ur looking at a whole clutch for comparison and know EXACTLY what to look for, those het albinos look to me just like any other normal. I wouldnt ever take a chance on a het albino based on those "markers". Plus, the "marker" is soooo subtle, that youd have a zillion newbs questioning whether or not their normals are het albinos....
I agree that het albino markers should only be used in a clutch situation to pick out hets from non hets,
but the markers are always there on a 100% het.
Quote:
almost the same thing with YBs. IMO, its way more confusing than helpful.
yb het clowns are so obvious that if you put a group of 50 yellowbellys and included 5 yb het clowns in that group it would be very easy to pull the yb hets out.
I still believe that most people have a hard enough time picking out hets in a clutch situation
that they shouldn't be trying to do it with an unknown snake.
Recessed instead of recessive maybe? or low visual incomplete dom, we can call it whatever but it doesn't change the fact that markers are real and that so called recessive traits are not so recessive after all.
|