Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 643

3 members and 640 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,105
Posts: 2,572,113
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 2 of 2
  1. #1
    Registered User
    Join Date
    02-15-2009
    Location
    alburtis, pa
    Posts
    29
    Thanks
    0
    Thanked 0 Times in 0 Posts

    100% Het yellow blush Albino

    just because you've never seen one doesn't mean it isnt' real. what did people think when the first spider was bred? i have the gen.s on it. my cousin is friends with the guy who breed this snake. he's been friends with him for quite a while. Right now he is suppose to have a snake that no one has. he bred it himself and won't release the gen. on it. there is someone else on this site that has one. here's the post.

    http://www.ball-pythons.net/forums/s...ad.php?t=31166

    like it says in the post:
    The only way to tell is that it was born black and silver like an axanthic. It then browns in the first shed. He is right about the snakes changing after first shed. here's the pictures of my snake and his 3 other siblings. he's one of the black and silver ball pythons.



    here's what he looks like now


    this one is a normal:


    there is not that much of a difference but with the genetics you can easily see there is a difference.

    this is the snake that the breeder has that he won't release the genetics on. so if you have another pictures of this snake from a different breeder pop it up somewhere. most of the morph's today were produced by people and probably most were questioned just like this guy.

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: 100% Het yellow blush Albino

    I think you might find this thread enlightening:

    http://ball-pythons.net/forums/showt...t=faded+albino
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1