» Site Navigation
0 members and 1,637 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,934
Threads: 249,128
Posts: 2,572,279
Top Poster: JLC (31,651)
|
-
Line Breeding / Outcrossing
I'm wondering what everyone's methodology/strategy is for out crossing their recessive bloodlines?
What kind of pairings would you feel comfortable with if you were dealing with a new recessive morph that has been line bred for proving out purposes?
How many generations of line breeding are you comfortable with before you start to worry about genetic deformaties?
What is the most efficient way to strengthen a recessive blood line?
Any other advice for working with recessive traits?
Thanks for the help!
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
-
Re: Line Breeding / Outcrossing
One thing to remember is that inbreeding does not cause deformities or other problems to spontaneously appear out of nowhere. The animals in question have to already carry a bad gene for it to be expressed in the inbred offspring.
However, what can happen is that a snake (or dog or human or...) may have for example, 4 recessive bad genes. If you breed it with something unrelated, the odds of any one of those bad genes being carried by the mate are slim, and it is extremely unlikely you'll hit more than one. But if you inbreed, then you may get all 4 of the bad traits expressed. This is why inbreeding is associated with "train wreck" levels of deformities or other issues.
Considering I don't think I've seen a single report of an actual case where BP inbreeding has caused issues, I would not be too concerned. What I have seen is that certain morphs have certain issues, but from what I've seen, it appears those issues are directly tied to the morph, rather than being a different gene that showed up due to inbreeding.
We know LOTS of breeders do projects where they breed father-daughter or brother-sister type pairings to prove out a morph or produce a new combo, so it seems highly likely that those are safe, otherwise we'd be hearing more reports of inbreeding related problems.
I don't think anyone knows for sure, though, so I would still avoid doing breeding where I am breeding multiple generations back to each other without introducing new blood. For example, to start with a het pied male x normal, take offspring from that and breed het back to phet daughters, take a pied male offspring from that and breed back to the phet females that proved out, take offspring from that and breed pied male back to pied daughters, take highest white brother & sister from that and breed together to try to select for high white... that's 5 generations of inbreeding, and no new blood! I'd avoid that.
On the other hand, to start with a het pied male x normal, take offspring from that and breed het back to phet daughters, take a pied male offspring from that and breed to a pastel female, take pastel het pied offspring from that and breed back to pied male, take pastel pied offspring from that and breed to a cinnamon, take pewter het pied brother & sister and breed together to produce... well, that clutch would be awesome wouldn't it? But the point is new blood is being introduced every other generation, and that is a lot less likely to have inbreeding issues show up.
As far as how to strengthen a bloodline... well, it depends on what you want to strengthen. If you just mean how to avoid problems due to inbreeding, doing an outcross every few generations will help, but nothing is guaranteed.
-
The Following User Says Thank You to kc261 For This Useful Post:
-
Re: Line Breeding / Outcrossing
I know that RDR started seeing issues when line breeding his granite Albino project. He was getting jack up albinos like no eyes short bottom jaws the works.
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
The Following User Says Thank You to Freakie_frog For This Useful Post:
-
Re: Line Breeding / Outcrossing
 Originally Posted by Freakie_frog
I know that RDR started seeing issues when line breeding his granite Albino project. He was getting jack up albinos like no eyes short bottom jaws the works.
I remember seeing a video of a really messed up clutch that Ralph produced. May be misremembering, but I thought it was a morph he was trying to prove out, and kept having issues.
If it was an already proven morph, and he was just trying to make a combo, that does lean more in the direction of an inbreeding issue than just an issue with the morph itself.
-
-
Registered User
Re: Line Breeding / Outcrossing
I think RDR also produced a normal clutch of albinos and they had missing eyes, jaw deformities, kinks and so on. I think he threw them all in the freezer.
-
-
BPnet Veteran
Re: Line Breeding / Outcrossing
Personally, If I were breedinga new recessive morph I would hope it was a male.
I would breed it to 2 seperate, unrelated normal females, and then breed their offspring.
I would try to keep things as 'clean' as possible.
"I don't want to make money, I just want to be wonderful." ~Marilyn Monroe
-
The Following User Says Thank You to Corvid For This Useful Post:
-
Re: Line Breeding / Outcrossing
 Originally Posted by Freakie_frog
I know that RDR started seeing issues when line breeding his granite Albino project. He was getting jack up albinos like no eyes short bottom jaws the works.
 Originally Posted by kc261
I remember seeing a video of a really messed up clutch that Ralph produced. May be misremembering, but I thought it was a morph he was trying to prove out, and kept having issues.
If it was an already proven morph, and he was just trying to make a combo, that does lean more in the direction of an inbreeding issue than just an issue with the morph itself.
It was the granite albino. He was trying to get offspring that look like the mother by breeding her sons back to her. He had done it twice IIRC and got train wrecks both times. He says in the breeding records page on it that line breeding probably will not work for that project.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
BPnet Veteran
Re: Line Breeding / Outcrossing
I personally will not do more than one generation of "inbreeding" when I start up my projects next year. I'm getting a Salmon Pastel boa that is the product of a son to mother breeding and that whole litter turned out just fine so I'd be comfortable with the one time.
IMO breeding 2 to 3 generations in is asking for trouble and at that point isn't so much about the health of the animals but for the money which is not ok.
2007 0.1 Jungle het Stripe Kahl Albino BCI
2008 1.0 Kahl Albino het Stripe BCI
2008 1.0 DH Kahl Sunglow BCI
2008 0.1 Anery 66% het Kahl Albino BCI
2008 0.1 Normal BCI
2009 1.0 Salmon Pastel BCI
2008 0.1 Normal Ball Python
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|