Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 575

0 members and 575 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 2 of 2 FirstFirst 12
Results 11 to 17 of 17
  1. #11
    BPnet Veteran
    Join Date
    09-14-2007
    Location
    Northern Virginia
    Posts
    3,250
    Thanks
    170
    Thanked 703 Times in 538 Posts

    Re: Honest opinions needed

    About the possible bone damage... I would think that if they had been damaged enough to cause this problem, it would have been apparent immediately, or at least almost immediately. Sort of like people don't walk around on a broken leg for years and then suddenly develop a limp. I'm just guessing. I'm glad to hear you have already spoken to your vet and are taking them to see him. I hope he can help.

    Quote Originally Posted by asplundii View Post
    That is not my pic. It is a screen shot from another forum. I captured it for a "bad person" thread on another site. I can provide further details via PM if you like.
    Sorry. When I posted about it, I should have said I saw the notation on the photo that it was not yours. I would appreciate a PM about it, thanks.
    Casey

  2. #12
    Registered User snakedork's Avatar
    Join Date
    02-19-2009
    Location
    michigan
    Posts
    161
    Thanks
    5
    Thanked 24 Times in 24 Posts

    Re: Honest opinions needed

    If you don't mind me asking what do you think the problem is maybe tht would help some of us out.

  3. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Honest opinions needed

    Quote Originally Posted by JLC View Post
    I imagine there aren't very many folks out there with much egg-eater experience, though.
    Yeah, not many egg-eater people out there...

    1. What do you THINK caused this? (You said you had an idea)
    Please read above, my post, #9

    2. When did you first notice evidence of something wrong?
    I noticed the first kink in the male almost a year ago.

    3. Did that something appear in both snakes at the same time? Or first one and then later the other?
    It appeared in the male first. As I noted above, he got a small kink about a year ago. His locomotion has been off for about 6 months. Only started seeing things in the female about 3 months ago and the locomotion problems for her started a month ago

    4. How fast have they "gone downhill" since you first noticed something wrong?
    What you saw in the vid of the female has appeared in only a months time. Before that she was slithering like normal.

    5
    . How much worse is the second one than the one shown in the vids?
    Significantly. He would not move or I would have taken a vid of him. Easiest explanation on his motion is imagine a really bad spider ball combined with what you saw in the female.

    6. What steps have you taken to try and correct the issue? (ie: extra feedings...calcium supplements...change in diet...medicines...change in environment?)
    I have not upped feeding, I did not want to stress them further and wanted to keep handling to a minimum.

    It is hard to calcium supplement, when they eat the eggs they spit the shell (normal behavior) and when I have had to tube them it is hard to get calcium supplement dissolved in the egg.

    I have not administered any meds or changed they living spaces

    7. Did your vet have any advice to offer at all? If so, what was it and were you able to follow it?
    Only advice he had was to observe and see how things went. To watch for worsening behavior (which is what prompted this posting and my call to see him this weekend). As I noted, he has no experience with these guys so he is wanting to be conservative in his approach which I understand.

    8. Have you seen any signs of improvement at all that might indicate a chance to turn it around?
    I have not seen any improvements.

    I don't know if we have any resident "egg-eater experts" around...
    Not many egg-eater keepers to begin with, I might be the only one on the board with them.

    but hopefully someone will be able to help you come to a reasonable and humane decision.
    That is my hope

    Thanks

    Quote Originally Posted by kc261 View Post
    About the possible bone damage... I would think that if they had been damaged enough to cause this problem, it would have been apparent immediately, or at least almost immediately. Sort of like people don't walk around on a broken leg for years and then suddenly develop a limp. I'm just guessing.
    Not always the case. As I noted earlier, with chondros people advocate you never pop them because damage does occur that can lead to a kink appearing days, weeks, months or even years later. I think the same type of thing is going on here. I believe they may have sustained damage early on, maybe from the seller, maybe from me (I have been extra careful but I am not going to say I might not have done something wrong, but if I did I do not recall it) and it is only now beginning to manifest.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #14
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,527
    Thanks
    9,263
    Thanked 6,788 Times in 4,306 Posts
    Images: 93

    Re: Honest opinions needed

    Hi,

    Are you certain it isn't a neurological or musculature problem rather than the bones themselves?

    Sorry to ask but it just occured to me looking at the way she moves - but I have zero experience of anything like this so figured I would ask.

    If your tube feeding would it be possible to put the vitamin supplements we sprinkle onto crickets through it if you made the mixture slightly more liquid or thicker (say with AD )?

    What mixture are you tube feeding them at the moment?

    Just in case the answers help someone think of any more suggestions or something.


    dr del
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

  5. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Honest opinions needed

    Quote Originally Posted by dr del View Post
    Hi,

    Are you certain it isn't a neurological or musculature problem rather than the bones themselves?
    Pretty sure. I know it is not obvious in the vids but she has 3 significant kinks and a couple other spots that I think are developing into kinks.

    Sorry to ask but it just occured to me looking at the way she moves - but I have zero experience of anything like this so figured I would ask.
    I do not mind you asking. I want other opinions, anything could spark me down a line of thought I have not come to yet.

    If your tube feeding would it be possible to put the vitamin supplements we sprinkle onto crickets through it if you made the mixture slightly more liquid or thicker (say with AD )?
    Maybe, difficulty is that 1) vit mixes do not go into egg yolk that well the times I have tried and 2) the feeding tube is a pretty fine gauge so "thick" things gum it up.

    What mixture are you tube feeding them at the moment?
    When I tube, I use quail egg yolk.

    Just in case the answers help someone think of any more suggestions or something.
    Yes please. Any thoughts are appreciated
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #16
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,527
    Thanks
    9,263
    Thanked 6,788 Times in 4,306 Posts
    Images: 93

    Re: Honest opinions needed

    Hi,

    Was thinking about the delicate bone problem while cleaning my male cornsnakes tank so he got used in a bit of an experiment;

    Do you think any idea like this could be adapted to prevent spinal damage?

    I know it wouldn't work for normal assist or force feeding because of the inability to expand but it might be ok for tube feeding maybe.



    Oh and if you ever wondered what a seriously miffed cornsnake looks like close up here it is;



    That was just a bit of spare aquarium tubing I had lying about but I think you could split it in two and make a hinge on one side ( silicon sealant and a rubber innertube from a bike tyre should work ) to simplify the process.

    Sorry just a wierd idea that occured.


    dr del
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

  7. #17
    BPnet Veteran Little B-Py's Avatar
    Join Date
    11-29-2008
    Location
    Nashville, TN
    Posts
    659
    Thanks
    82
    Thanked 25 Times in 24 Posts
    Images: 18

    Re: Honest opinions needed

    Quote Originally Posted by dr del View Post
    Oh and if you ever wondered what a seriously miffed cornsnake looks like close up here it is;

    That doesn't look like a happy corn. lol.
    Steffen, pronounced with f's, not v's
    1.0 Normal BP, Oakley; 0.1 Normal BP, Hissy Fit; 1.0 Savannah Monitor, Abraxas, RIP 2-1-09; 0.0.1 Pacman Frog, Twoey; 1.0 BCI/BCC Cross, Quetzalcoatl "Q"; 0.0.1 Crestie - Flametail; 0.0.1 Crestie - Nuala; 0.1 Emp Scorpion - Black Arachnia; 0.1 ATB - Cortana; 0.0.1 Savvy - Lohe; 0.1 Colombian RTB, Queen Zida; 1.0 Common Boa; 0.0.1 Beardie

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1