Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 725

1 members and 724 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,108
Posts: 2,572,140
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Results 1 to 10 of 16

Threaded View

  1. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Turning a glass tank vertical?

    I do not have a pic on me but I have a 10g that was set up this way for some small treefrogs. I'll pop a couple pic tonight and post them tomorrow

    The quick and dirty way (3 days set up time, mostly waiting on glue to cure):

    -Get a pane of glass cut to 3" shorter than the length, then cut this in half.

    -Silicone the lower one into place (I run a bead inside and then go back over the outside seam) and let dry before next step

    -Along the inward facing side of the second pane along the edge that will meet up with the affixed pane, run a length of masking tape. Place the loose pane on top of the affixed pane and tape together (basically you are creating a hinge with the tape.)

    -Fold the loose pane up so it is now resting in the recess.

    -Run lengths of masking tape 1/2" above and below the seam where the two panes meet (if your masking tape from the above step is on the outside you messed up, flip the loose pane over

    -Place a nickle on each end of both pieces of tape.

    -Run a very generous bead of silicon over the seam. And I do mean generous, you are going to want enough to cover the entire 1" section of exposed glass between the tape strips.)

    -Wrap a heavy book/board/flat something in foil

    -Smear a strip of vasaline on the foil.

    -Set your wrapped flat something down so that the nickles act as spacers keeping it above the glass. You want to "flatten" the silicon bead

    -Let dry with flat somthing in place

    -Remove flat something (the vasiline should make this easy.

    -Remove maskin tape from outside.

    -You should now have a silicon hinge.

    -Fold loose pane back and remove tape from inside.

    -For the 3" gap you have at the top, use screen frame and screen to make a little screen window (I can talk you through that too if you need.)

    -Silicone screen into place.

    -Mount a pair of swivle locks on the screen frame, these will lock the loose pane in position.

    -Silicone a knob on the top of the loose pane.

    -Right tank and set up for inhabitants.


    For a bit more involved method you can mount sliding track. I can talk you through that too if you want.

    Cheers
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Clyde Frog (02-18-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1