Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 605

1 members and 604 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,915
Threads: 249,118
Posts: 2,572,196
Top Poster: JLC (31,651)
Welcome to our newest member, KBFalconer
Page 5 of 7 FirstFirst 1234567 LastLast
Results 41 to 50 of 64

Thread: ??What price??

  1. #41
    BPnet Senior Member joepythons's Avatar
    Join Date
    12-03-2005
    Posts
    12,500
    Thanks
    697
    Thanked 1,074 Times in 888 Posts
    Images: 1

    Re: ??What price??

    Ok if these are supposed to be able to create this yellow blush albinos and she is just getting into ball pythons.Then why is she selling them? I would think this would be a big foot in the door in the ball python world.
    Joe Haggard

  2. #42
    Registered User
    Join Date
    03-25-2008
    Posts
    36
    Thanks
    0
    Thanked 0 Times in 0 Posts
    Images: 5

    Re: ??What price??

    If you must know the personal dealing of what is going on, which in this case because of the genetics, it may be beneficial to justify the sale...

    The reason for the sale is this.

    I am getting married on March 21st of this year. As we ALL know, marriage is a very expensive ordeal, and I am moving to a new house with my wife as soon as we come back from the honeymoon and she doesnt like snakes. So they needed to go to help fund the wedding and for respect for my future wifes lack of love for the reptiles.

    With all the preparations going on, I have not had the personal time to take to sell these animals, and I needed money right away for wedding expenses.

    As a way to help me out... I sold all my snakes to my cousins wife, because she has some free time to then post them for sale. I have been talking to her to help her with the postings. She is not keeping them because I got her heavily into Bearded Dragon Morphs and she has been breeding them wants to focus on them.

    So in order to recoup the money she gave to me for the snakes, she is posting them for sale.

    I hope that clears anything confusion up for you.

  3. #43
    BPnet Senior Member joepythons's Avatar
    Join Date
    12-03-2005
    Posts
    12,500
    Thanks
    697
    Thanked 1,074 Times in 888 Posts
    Images: 1

    Re: ??What price??

    I removed the info from fauna on my own because its not needed here.So sell your snakes to whom ever will take a chance.
    Joe Haggard

  4. #44
    Registered User
    Join Date
    03-25-2008
    Posts
    36
    Thanks
    0
    Thanked 0 Times in 0 Posts
    Images: 5

    Re: ??What price??

    Thank you for removal of the link. It was very mature and upstanding of you.
    Last edited by MetalStryker; 02-17-2009 at 10:41 PM. Reason: Update to post below

  5. #45
    BPnet Senior Member joepythons's Avatar
    Join Date
    12-03-2005
    Posts
    12,500
    Thanks
    697
    Thanked 1,074 Times in 888 Posts
    Images: 1

    Re: ??What price??

    Quote Originally Posted by MetalStryker View Post
    I have known Steve personally for 7 years now.

    This story that you posted a link to was started because of an article posted in the local paper here in my area.

    Now, I know that MANY people believe everything that is printed in the paper. But you, more than anyone.. should know that the media makes anything to do with snakes look bad.

    I know what is said in that forum thread does look bad.. However, I was there, I know first hand everything that went on with that situation, and it was NOT AT ALL how the paper said it was. Steve was a victim in this case by some very bad people.

    Out of respect for Steve, i am going to say it is not my place to bring up that situation in this thread. I think those accusations should stay in and be cleared up in that thread.

    All I will say with that situation is that Steve have NEVER treated his animals poorly, and has always put them before his own needs, even in tough times, they have eaten before him.

    I know the condition of his animals, seeing as I have worked for him many years. So personally have cleaned them up.

    Please be respectful. I acknowledge that thread exists.. but in this case.. we are talking about the existance of a morph.. while reputation does come into play.. lets keep BOI threads in their place so as not to bring daram to another site.

    Thank you.
    Hence why i removed it .
    Joe Haggard

  6. #46
    BPnet Veteran SPJ's Avatar
    Join Date
    09-23-2005
    Posts
    2,887
    Thanks
    64
    Thanked 113 Times in 79 Posts
    Images: 1

    Re: ??What price??

    A yellow blush is a line of albino just like the faded and high contrast lines.
    The yellow blush albinos tends to have more of a solid yellow head and the yellow bleeds out more into where the white would be making a more uniform yellow colored snake.
    The one odd thing about this line is that you can visually tell which normals are hets and which ones aren't when they emerge from the egg.
    The hets have an axanthic look to them but change to a more normal coloring after their first shed.
    Not many people where working with this line due to the originator of it but they are out there and will become increasingly more available over the next few years.

  7. The Following User Says Thank You to SPJ For This Useful Post:

    joepythons (02-18-2009)

  8. #47
    BPnet Senior Member joepythons's Avatar
    Join Date
    12-03-2005
    Posts
    12,500
    Thanks
    697
    Thanked 1,074 Times in 888 Posts
    Images: 1

    Re: ??What price??

    Quote Originally Posted by SPJ View Post
    A yellow blush is a line of albino just like the faded and high contrast lines.
    The yellow blush albinos tends to have more of a solid yellow head and the yellow bleeds out more into where the white would be making a more uniform yellow colored snake.
    The one odd thing about this line is that you can visually tell which normals are hets and which ones aren't when they emerge from the egg.
    The hets have an axanthic look to them but change to a more normal coloring after their first shed.
    Not many people where working with this line due to the originator of it but they are out there and will become increasingly more available over the next few years.
    Steve i know i can trust you so i stand corrected here
    Joe Haggard

  9. #48
    Registered User
    Join Date
    02-09-2009
    Posts
    72
    Thanks
    20
    Thanked 18 Times in 15 Posts

    Re: ??What price??

    Not to sound rude but you basically just admitted you were wrong about this which is admirable. But you also spent the better part of the day calling a new seller a liar and demeaning her. I think an apology is in order. Hide behind the claim that you were trying to "warn" her about MKR "scams" all you want but the fact remains that even when she revealed that the hets were from a completely different breeder you were relentless.

    Bloodsong

  10. #49
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: ??What price??

    Quote Originally Posted by SPJ View Post
    The one odd thing about this line is that you can visually tell which normals are hets and which ones aren't when they emerge from the egg.
    The hets have an axanthic look to them but change to a more normal coloring after their first shed.
    Steve,

    Asking this purely out of my own curiosity to better understand this variant and my theory behind it. Is this statement an absolute? Have all the "axanthic" looking switchers proven to be hets?

    Thanks
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. #50
    BPnet Veteran SPJ's Avatar
    Join Date
    09-23-2005
    Posts
    2,887
    Thanks
    64
    Thanked 113 Times in 79 Posts
    Images: 1

    Re: ??What price??

    Quote Originally Posted by asplundii View Post
    Steve,

    Asking this purely out of my own curiosity to better understand this variant and my theory behind it. Is this statement an absolute? Have all the "axanthic" looking switchers proven to be hets?

    Thanks
    As far as I know, ALL of the hets have had the different look when they hatched.

  12. The Following User Says Thank You to SPJ For This Useful Post:

    asplundii (02-18-2009)

Page 5 of 7 FirstFirst 1234567 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1