Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 608

0 members and 608 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,915
Threads: 249,118
Posts: 2,572,196
Top Poster: JLC (31,651)
Welcome to our newest member, KBFalconer
Page 3 of 7 FirstFirst 1234567 LastLast
Results 21 to 30 of 64

Thread: ??What price??

  1. #21
    Registered User
    Join Date
    02-15-2009
    Location
    alburtis, pa
    Posts
    29
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: ??What price??

    Quote Originally Posted by asplundii View Post
    Umm... The Energy Ball is not an albino so I am not sure how it relates to the "blush" albinos we are discussing in this thread ???
    sorry i guess it really doesn't have anything to do with the albinos, but the same guy that breed this snake is where my cousin got the 100% het albino and the 100% het yellow blush albino from. so i guess i just threw that on there just to let everyone know that i didn't get these snakes from some fraud company who never bred snakes before. this guy knows what he's doing. from what i've been talk he's been doing this for 25+years.

  2. #22
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: ??What price??

    Ah, gotcha. I thought you were saying the Energy was some kind of "blush" albino... My mistake
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #23
    Registered User
    Join Date
    02-15-2009
    Location
    alburtis, pa
    Posts
    29
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: ??What price??

    the snake is actually for sale. i am not sure what he wants for it but i am sure it's a lot.

  4. #24
    BPnet Senior Member joepythons's Avatar
    Join Date
    12-03-2005
    Posts
    12,500
    Thanks
    697
    Thanked 1,074 Times in 888 Posts
    Images: 1

    Re: ??What price??

    Quote Originally Posted by dakotachristy84 View Post
    just because you've never seen one doesn't mean it isnt' real. what did people think when the first spider was bred? i have the gen.s on it. my cousin is friends with the guy who breed this snake. he's been friends with him for quite a while. Right now he is suppose to have a snake that no one has. he bred it himself and won't release the gen. on it. there is someone else on this site that has one. here's the post.

    http://www.ball-pythons.net/forums/s...ad.php?t=31166

    like it says in the post:
    The only way to tell is that it was born black and silver like an axanthic. It then browns in the first shed. He is right about the snakes changing after first shed. here's the pictures of my snake and his 3 other siblings. he's one of the black and silver ball pythons.



    here's what he looks like now


    this one is a normal:


    there is not that much of a difference but with the genetics you can easily see there is a difference.

    this is the snake that the breeder has that he won't release the genetics on. so if you have another pictures of this snake from a different breeder pop it up somewhere. most of the morph's today were produced by people and probably most were questioned just like this guy.
    Well i would like to see this blush albino not a het.Since you linked this to the thread involving Andre i was the one whom revealed to him that he was ripped of by MKR since there is no such thing as a blush albino ball python.Sorry but i dont buy this guy has them but does not give info on the genetics.I have been around long enough to know the truth about ball pythons and the needed genetics to produce them.The way you are describing these snakes is exactly how Andre explained them to me way back then.The only thing you "might" have is a het for albino ball python pair.I say might be because its obvious the snakes Andre had are involved here.Now take a second and think about why Andre dumped his snakes.If they were het for this new morph he would have been in the money by now but he realized the truth and dumped them.Once again if you can show me a pic of a blush albino(not a normal albino or lavender) i will believe you then and only then.Sorry to be blunt here
    Joe Haggard

  5. #25
    BPnet Veteran ColinWeaver's Avatar
    Join Date
    10-21-2008
    Location
    Hampton Roads area, Virginia
    Posts
    225
    Thanks
    78
    Thanked 711 Times in 103 Posts

    Re: ??What price??

    A 700g female spider is worth a lot more than $400.
    Colin Weaver
    East Coast Reptile Breeders
    http://www.ballpythonbreeder.com/
    Email: colin@ballpythonbreeder.com
    Phone: 757-572-1987 (Call or Text)


  6. #26
    Registered User
    Join Date
    02-15-2009
    Location
    alburtis, pa
    Posts
    29
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: ??What price??

    Quote Originally Posted by ColinWeaver View Post
    A 700g female spider is worth a lot more than $400.
    but the problem is getting someone to pay for her. i have someone coming up on the 23 to check out the 2 het pair if he takes them for $450 i'm thinking about keeping the spider and the pastel and breeding them. also still getting rid of the 2 normals. i've never shipped a snake before. i've had a bearded dragon shipped to me so i know how it's done.

  7. #27
    Registered User
    Join Date
    02-15-2009
    Location
    alburtis, pa
    Posts
    29
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: ??What price??

    Quote Originally Posted by joepythons View Post
    Well i would like to see this blush albino not a het.Since you linked this to the thread involving Andre i was the one whom revealed to him that he was ripped of by MKR since there is no such thing as a blush albino ball python.Sorry but i dont buy this guy has them but does not give info on the genetics.I have been around long enough to know the truth about ball pythons and the needed genetics to produce them.The way you are describing these snakes is exactly how Andre explained them to me way back then.The only thing you "might" have is a het for albino ball python pair.I say might be because its obvious the snakes Andre had are involved here.Now take a second and think about why Andre dumped his snakes.If they were het for this new morph he would have been in the money by now but he realized the truth and dumped them.Once again if you can show me a pic of a blush albino(not a normal albino or lavender) i will believe you then and only then.Sorry to be blunt here
    i didn't mean he wouldn't give me the genetics on the 100% het yellow blush albino snake, was he won't do it on this snake



    i have the genetics on the yellow blush

  8. #28
    BPnet Senior Member joepythons's Avatar
    Join Date
    12-03-2005
    Posts
    12,500
    Thanks
    697
    Thanked 1,074 Times in 888 Posts
    Images: 1

    Re: ??What price??

    Quote Originally Posted by dakotachristy84 View Post
    i didn't mean he wouldn't give me the genetics on the 100% het yellow blush albino snake, was he won't do it on this snake



    i have the genetics on the yellow blush
    I am only talking about this yellow blush albino stuff not this other snake.You posted info on morph king reptiles bieng the first to produce this snake.One big problem they NEVER produced 1 single snake the entire time the clowns were together.They bought everything they sold from REAL breeders and lied to thousands of people until they got busted.The only albino ball pythons in existence are the albino and the lavender albino period.I just did a google search and the only info that pops up about this "yellow blush thingy" is from MKR AKA lieing scammers.So if your friend has these yellow blush albinos i want to see a pic of one.If they are real someone has to have the morph as hets dont run forever
    Joe Haggard

  9. #29
    Registered User
    Join Date
    02-15-2009
    Location
    alburtis, pa
    Posts
    29
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: ??What price??

    Quote Originally Posted by joepythons View Post
    Well i would like to see this blush albino not a het.Since you linked this to the thread involving Andre i was the one whom revealed to him that he was ripped of by MKR since there is no such thing as a blush albino ball python.Sorry but i dont buy this guy has them but does not give info on the genetics.I have been around long enough to know the truth about ball pythons and the needed genetics to produce them.The way you are describing these snakes is exactly how Andre explained them to me way back then.The only thing you "might" have is a het for albino ball python pair.I say might be because its obvious the snakes Andre had are involved here.Now take a second and think about why Andre dumped his snakes.If they were het for this new morph he would have been in the money by now but he realized the truth and dumped them.Once again if you can show me a pic of a blush albino(not a normal albino or lavender) i will believe you then and only then.Sorry to be blunt here

    i found this website. it's in the 4th row down. http://www.suburbanpythons.co.uk/gallery.htm

    if you still don't think the yellow blush is real then contact steven directly. google him or google serpents den cuz i am done with it.

  10. #30
    BPnet Senior Member joepythons's Avatar
    Join Date
    12-03-2005
    Posts
    12,500
    Thanks
    697
    Thanked 1,074 Times in 888 Posts
    Images: 1

    Re: ??What price??

    Quote Originally Posted by dakotachristy84 View Post
    i found this website. it's in the 4th row down. http://www.suburbanpythons.co.uk/gallery.htm

    if you still don't think the yellow blush is real then contact steven directly. google him or google serpents den cuz i am done with it.
    Well that only shows it was a pic provided by MKR.I do not need to contact anyone because i know the truth.If you have not noticed numerous breeders have observed this thread and not one has chimed in to correct me if thier really was a real yellow blush albino ball python.So i think that is enough proof in itself .Sorry if i upset you but someone had to let you know the truth here.
    Joe Haggard

Page 3 of 7 FirstFirst 1234567 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1