» Site Navigation
0 members and 671 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,915
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
Registered User
Re: ??What price??
so for the spider 400 is good price and the pastel 250??
any idea on the others?? i know about i should try and get more for the adult female cuz she is breeding size.
-
-
Registered User
Re: ??What price??
 Originally Posted by Kaorte
07' 1.0 pastel $75
07' 0.1 spider $400
07' 1.0 100% het yellow blush albino What is this??
07' 0.1 100% het albino $200
07' normal 0.1 $150
04' normal 0.1 $150
These are just estimations based on what I have seen. I could be wrong  . I agree, look on kingsnake or fauna classifieds to get a better idea of price.
here's more info on the yellow blush albino
http://images.google.com/imgres?imgu...3Doff%26sa%3DN
-
-
Re: ??What price??
 Originally Posted by dakotachristy84
A little info for you about the "blush albino" snake.Its a line of bull crap just like MKR is.They were proving to be scammers several times over.So it is only a het albino and thats only if you have genetic papers to prove it.If it has MKR sig as them being the breeders then its probably worthless since they never bred one single snake.They bought snakes from others and lied to TONS of people.Sorry if i sound rude here i am just trying to let you know the truth.
-
-
Registered User
-
-
Registered User
Re: ??What price??
I would definitely ask for more for the Spider. $700+
 _____________________________________________
Ivy
_____________________________________________
BPs: 1.0 Normals,1.0 Pastels, 0.1 Dinkers
Other Herps:
6.20 Bearded Dragons (Hypos, Trans, Leathebacks, Reds, etc.), 1.1 Knob Tail Geckos
Other:
0.1 Mini American Eskimos, 1.0 Chihuahuas, 0.1 Terrier Mixes, 1.0 Chihuahua/Toy Fox Terrier Mixes
1.0 Double Rex, 0.1 Beige Ruby Eyed Dumbo, 0.1 Hairless PEW
-
-
BPnet Veteran
Re: ??What price??
 Originally Posted by dakotachristy84
just because you've never seen one doesn't mean it isnt' real. what did people think when the first spider was bred? i have the gen.s on it. my cousin is friends with the guy who breed this snake. he's been friends with him for quite a while. Right now he is suppose to have a snake that no one has. he bred it himself and won't release the gen. on it. there is someone else on this site that has one. here's the post.
http://www.ball-pythons.net/forums/s...ad.php?t=31166
like it says in the post:
The only way to tell is that it was born black and silver like an axanthic. It then browns in the first shed. He is right about the snakes changing after first shed. here's the pictures of my snake and his 3 other siblings. he's one of the black and silver ball pythons.
here's what he looks like now
this one is a normal:
there is not that much of a difference but with the genetics you can easily see there is a difference.
this is the snake that the breeder has that he won't release the genetics on. so if you have another pictures of this snake from a different breeder pop it up somewhere. most of the morph's today were produced by people and probably most were questioned just like this guy.
I don't get it... so it's a morph that looks exactly like a normal?
-
-
Re: ??What price??
I thought I posted this in here but I may be delusional...
I think you might find this thread enlightening:
http://ball-pythons.net/forums/showt...t=faded+albino
I have not researched it much more since then but I stand by the comment that I made in that thread. Basically it is as Joe mentioned above. Only guarantee your snake is a het albino is if it had an albino parent. The agent responsible for the switch from axanthic-looking to normal looking may or may not be tied directly to the albino allele. I have my suspicions but they are just that. I can not find anyone with a solid reputation that has done the necessary work to prove one way or another so I do not think you can guarantee that these silver to brown switchers are 100% hets based on that trait alone.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: ??What price??
 Originally Posted by joepythons
A little info for you about the "blush albino" snake.Its a line of bull crap just like MKR is.They were proving to be scammers several times over.So it is only a het albino and thats only if you have genetic papers to prove it.If it has MKR sig as them being the breeders then its probably worthless since they never bred one single snake.They bought snakes from others and lied to TONS of people.Sorry if i sound rude here i am just trying to let you know the truth.
Ok now i know what you meant by the snake. i had no idea that MKR were scammers. But i guess that's a good thing that i didn't get it from them. The breeder is Steve Markevich. he owns serpents den. google it. he's on myspace. he's the one that breed the 100% het albino and the 100% het yellow blush albino. he sold them to my cousin Rory. you can talk to him on myspace and ask him. he also bred this snake.

ok for some reason the picture didn't come up on the last post. if you can find another snake that looks like this one let me know.
Last edited by dakotachristy84; 02-17-2009 at 01:35 PM.
-
-
Registered User
-
-
Re: ??What price??
Umm... The Energy Ball is not an albino so I am not sure how it relates to the "blush" albinos we are discussing in this thread ???
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|