Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,498

0 members and 1,498 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Page 1 of 2 12 LastLast
Results 1 to 10 of 17
  1. #1
    BPnet Senior Member anatess's Avatar
    Join Date
    11-13-2008
    Posts
    1,799
    Thanks
    133
    Thanked 502 Times in 311 Posts
    Images: 5

    Opinions on an Albino

    Hi all,
    I found this '08 female albino on an ad. There is another picture of her in the ad but it is not a good shot. This is the better one of the two even if it is not that great either. Do you think she's a good specimen? Would you pay $400 for her? I don't have any specifics as far as weight, temperament, etc. All it says is that she eats both f/t or live mice and that the owner has to sell to pay his rent. I'm thinking of giving this to my husband as a present. He is a big fan of albinos while I'm not really much into them - I love spiders - so I really don't know what constitutes a good albino pattern. What do you guys think? Is she a good pick-up?

    ----------------------------------
    BP owner since Oct 2008, so yeah, I'm no expert.
    0.1.0 pastel bp
    1.0.0 spider bp
    0.1.0 albino bp
    1.0.0 bumblebee bp
    1.0.0 yellowbelly bp
    0.0.1 normal bp
    1.0.0 normal western hognose


    Life should NOT be a journey to the grave with the intention of arriving safely in an attractive and well preserved body, but rather to skid in sideways, chocolate in one hand, body thoroughly used up, totally worn out and screaming "WOO HOO what a ride!"

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Opinions on an Albino

    Well the pic is kind of small so it is hard to tell really. Really it is all about personal taste though, do you know what your husband like as far as pattern is concerned??

    Also, $400 seems low for a female 'bino, have you checked the seller out to make sure they are legit? I would be more inclined to go with someone you know is safe even if they are a bit more expensive. Just me personally though.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #3
    Registered User JeffJ's Avatar
    Join Date
    02-13-2009
    Location
    London, Canada
    Posts
    1,039
    Thanks
    74
    Thanked 127 Times in 113 Posts
    Images: 3

    Re: Opinions on an Albino

    if you can pop your self i would sex her to be sure before you pay $400, or probe her.

    and if its a craigs list add its probably bull. there are allot on there
    Last edited by JLC; 02-17-2009 at 03:32 PM. Reason: Language. Warning already given for another post after this one was made.

  4. #4
    BPnet Senior Member anatess's Avatar
    Join Date
    11-13-2008
    Posts
    1,799
    Thanks
    133
    Thanked 502 Times in 311 Posts
    Images: 5

    Re: Opinions on an Albino

    I know my husband is in love with Mike Cavanaugh's albino pictured here:



    It is bright yellow (is that what's called a high-contrast?).

    Oh, and yes, it's from craigslist. So, yeah... probably should just wait for a "reputable breeder" one.
    ----------------------------------
    BP owner since Oct 2008, so yeah, I'm no expert.
    0.1.0 pastel bp
    1.0.0 spider bp
    0.1.0 albino bp
    1.0.0 bumblebee bp
    1.0.0 yellowbelly bp
    0.0.1 normal bp
    1.0.0 normal western hognose


    Life should NOT be a journey to the grave with the intention of arriving safely in an attractive and well preserved body, but rather to skid in sideways, chocolate in one hand, body thoroughly used up, totally worn out and screaming "WOO HOO what a ride!"

  5. #5
    Registered User
    Join Date
    01-09-2009
    Location
    Buffalo, NY
    Posts
    184
    Thanks
    25
    Thanked 17 Times in 16 Posts

    Re: Opinions on an Albino

    Why rule it out right away, thats kind of the beauty of Craigslist over Kingsnake or something else online isn't it, that it is local so you should at least contact the guy and go check her out. No use passing up a great deal if it is legit.

  6. #6
    Registered User MUSTANGGTANDGSXR's Avatar
    Join Date
    12-03-2008
    Location
    Citrus County, FL
    Posts
    187
    Thanks
    8
    Thanked 26 Times in 24 Posts
    Images: 1

    Re: Opinions on an Albino

    its a scam i tried emailing them and nothing. there was another one with the same picture a few days ago and the guy told me it was sold, and then the ad was erased so who knows.
    Racing... because baseball, basketball, football and soccer only use one ball.

  7. #7
    BPnet Veteran andwhy6's Avatar
    Join Date
    01-30-2007
    Location
    Seattle, Washington
    Posts
    645
    Thanks
    6
    Thanked 20 Times in 16 Posts
    Images: 7

    Re: Opinions on an Albino

    you should always check on those. there was a male albino along with a het albino female for 350 in my area a few weeks back. it was legit. if i had the cash they would have been mine for sure. so just because it seems too good to be true sometimes its not. remember people need cash cuz the U.S. sucks
    pin albino bp in the making

  8. #8
    BPnet Senior Member Mike Cavanaugh's Avatar
    Join Date
    12-23-2007
    Location
    jacksonville, fl
    Posts
    3,431
    Thanks
    623
    Thanked 1,022 Times in 458 Posts
    Images: 2

    Re: Opinions on an Albino

    like everyone mentioned, the price being so low is a warning sign... BUT that does not mean it is a legit deal. I would contact them and get more info. There are lots of albinos that eat just fine (like mine) but there are also lots of them that are very difficult feeders.

    If I were buying it, I would ask to see it feed in its normal setup before buying.... but that is just me.

    What mustang said makes it even more questionable in my eyes.

    Keep us posted. It looks great given that it is a terrible picture.

    Mike
    Mikey Cavanaugh
    (904) 318-3333

  9. #9
    BPnet Senior Member anatess's Avatar
    Join Date
    11-13-2008
    Posts
    1,799
    Thanks
    133
    Thanked 502 Times in 311 Posts
    Images: 5

    Re: Opinions on an Albino

    I will attest to the fact that my family has gone snake-crazy. They have. It's so bad that they're borderline unreasonable. I showed this thread to my husband and told him about what y'all think. Do you think it mattered? Heck, no. He decided to drive 2 hours to Orlando to check out the snake, 2 kids in tow, ON A SCHOOL NIGHT! Anyway, this is how crazy it went - I sent the guy an email asking for information. He said he got the snake from a Repticon show in Orlando last year. Said the snake was born in July. Guaranteed female by both the breeder at the Repticon show and his local vet. Very easy-going - he has kids too that play with the snake a lot. But, he said she is a picky eater. He said she is offered food every week but she misses weeks lots of times. He said he can meet tonight. Well, I thought the "picky eater" part will discourage my husband, but no. He still wanted to see it. So he gets off work, tells the kids to pack up because we're going on a roadtrip. I didn't even get the guy's phone number yet and where we are supposed to meet! Anyway, an hour into the drive he finally calls me and we set up a meeting place - this gas station by I-4. So we get there, my husband checks the snake out, talks to the guy for quite some time (he is a young, nice guy!), goes to the ATM at the gas station and hands the guy 400 bucks. My jaw dropped. I didn't expect to get the snake on the spot! I thought we were going to sleep over it first. Well, too late now. I don't even have an enclosure prepared yet. I know, bad right? So, we get home at midnight, I scramble to get an enclosure readied. I got a 10-gallon with a heat lamp with a night glo bulb (whew!). I had to mutilate 2 tupperwares to use as hides and another tupperware for the water bowl. She is on newspaper until she gets a vet visit. No temp or humidity gauges, no thermostat, nothing. I know I'm not doing this right but I'm doing the best I can with what I have. I have to say, she is pretty for an albino (I'm not a big fan of albinos). I still think Mike's snake is prettier though (brighter yellow). I don't know what came over my family. We've seen several albinos for sale at the pet store and online ads. But for some reason, my husband just had this crazy urge to get this one. I'll post pictures when I get a chance. I'll be busy getting her a proper enclosure tomorrow!
    ----------------------------------
    BP owner since Oct 2008, so yeah, I'm no expert.
    0.1.0 pastel bp
    1.0.0 spider bp
    0.1.0 albino bp
    1.0.0 bumblebee bp
    1.0.0 yellowbelly bp
    0.0.1 normal bp
    1.0.0 normal western hognose


    Life should NOT be a journey to the grave with the intention of arriving safely in an attractive and well preserved body, but rather to skid in sideways, chocolate in one hand, body thoroughly used up, totally worn out and screaming "WOO HOO what a ride!"

  10. #10
    Registered User gixxerrobballs's Avatar
    Join Date
    01-30-2009
    Posts
    234
    Thanks
    85
    Thanked 32 Times in 32 Posts
    Images: 6

    Re: Opinions on an Albino

    glad everything worked out..........
    Robert's Reptiles
    1.0 mystic
    0.1 pastel butter
    1.0 pastel yellow belly
    1.1 mojave
    0.1 cinny
    0.7 normals

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1