Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 616

2 members and 614 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,915
Threads: 249,118
Posts: 2,572,196
Top Poster: JLC (31,651)
Welcome to our newest member, KBFalconer
Page 2 of 7 FirstFirst 1234567 LastLast
Results 11 to 20 of 64

Thread: ??What price??

  1. #11
    Registered User
    Join Date
    02-15-2009
    Location
    alburtis, pa
    Posts
    29
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: ??What price??

    so for the spider 400 is good price and the pastel 250??
    any idea on the others?? i know about i should try and get more for the adult female cuz she is breeding size.

  2. #12
    Registered User
    Join Date
    02-15-2009
    Location
    alburtis, pa
    Posts
    29
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: ??What price??

    Quote Originally Posted by Kaorte View Post
    07' 1.0 pastel $75
    07' 0.1 spider $400
    07' 1.0 100% het yellow blush albino What is this??
    07' 0.1 100% het albino $200
    07' normal 0.1 $150
    04' normal 0.1 $150

    These are just estimations based on what I have seen. I could be wrong . I agree, look on kingsnake or fauna classifieds to get a better idea of price.
    here's more info on the yellow blush albino

    http://images.google.com/imgres?imgu...3Doff%26sa%3DN

  3. #13
    BPnet Senior Member joepythons's Avatar
    Join Date
    12-03-2005
    Posts
    12,500
    Thanks
    697
    Thanked 1,074 Times in 888 Posts
    Images: 1

    Re: ??What price??

    Quote Originally Posted by dakotachristy84 View Post
    here's more info on the yellow blush albino

    http://images.google.com/imgres?imgu...3Doff%26sa%3DN
    A little info for you about the "blush albino" snake.Its a line of bull crap just like MKR is.They were proving to be scammers several times over.So it is only a het albino and thats only if you have genetic papers to prove it.If it has MKR sig as them being the breeders then its probably worthless since they never bred one single snake.They bought snakes from others and lied to TONS of people.Sorry if i sound rude here i am just trying to let you know the truth.
    Joe Haggard

  4. #14
    Registered User
    Join Date
    02-15-2009
    Location
    alburtis, pa
    Posts
    29
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: ??What price??

    just because you've never seen one doesn't mean it isnt' real. what did people think when the first spider was bred? i have the gen.s on it. my cousin is friends with the guy who breed this snake. he's been friends with him for quite a while. Right now he is suppose to have a snake that no one has. he bred it himself and won't release the gen. on it. there is someone else on this site that has one. here's the post.

    http://www.ball-pythons.net/forums/s...ad.php?t=31166

    like it says in the post:
    The only way to tell is that it was born black and silver like an axanthic. It then browns in the first shed. He is right about the snakes changing after first shed. here's the pictures of my snake and his 3 other siblings. he's one of the black and silver ball pythons.



    here's what he looks like now


    this one is a normal:


    there is not that much of a difference but with the genetics you can easily see there is a difference.

    this is the snake that the breeder has that he won't release the genetics on. so if you have another pictures of this snake from a different breeder pop it up somewhere. most of the morph's today were produced by people and probably most were questioned just like this guy.

  5. #15
    Registered User Muze's Avatar
    Join Date
    08-08-2008
    Location
    Ft. Lauderdale
    Posts
    1,055
    Thanks
    370
    Thanked 207 Times in 174 Posts

    Re: ??What price??

    I would definitely ask for more for the Spider. $700+
    _____________________________________________
    Ivy
    _____________________________________________
    BPs: 1.0 Normals,1.0 Pastels, 0.1 Dinkers
    Other Herps:
    6.20 Bearded Dragons (Hypos, Trans, Leathebacks, Reds, etc.), 1.1 Knob Tail Geckos
    Other:
    0.1 Mini American Eskimos, 1.0 Chihuahuas, 0.1 Terrier Mixes, 1.0 Chihuahua/Toy Fox Terrier Mixes
    1.0 Double Rex, 0.1 Beige Ruby Eyed Dumbo, 0.1 Hairless PEW

  6. #16
    BPnet Veteran
    Join Date
    09-09-2008
    Location
    Ohio
    Posts
    238
    Thanks
    29
    Thanked 29 Times in 25 Posts
    Images: 13

    Re: ??What price??

    Quote Originally Posted by dakotachristy84 View Post
    just because you've never seen one doesn't mean it isnt' real. what did people think when the first spider was bred? i have the gen.s on it. my cousin is friends with the guy who breed this snake. he's been friends with him for quite a while. Right now he is suppose to have a snake that no one has. he bred it himself and won't release the gen. on it. there is someone else on this site that has one. here's the post.

    http://www.ball-pythons.net/forums/s...ad.php?t=31166

    like it says in the post:
    The only way to tell is that it was born black and silver like an axanthic. It then browns in the first shed. He is right about the snakes changing after first shed. here's the pictures of my snake and his 3 other siblings. he's one of the black and silver ball pythons.



    here's what he looks like now


    this one is a normal:


    there is not that much of a difference but with the genetics you can easily see there is a difference.

    this is the snake that the breeder has that he won't release the genetics on. so if you have another pictures of this snake from a different breeder pop it up somewhere. most of the morph's today were produced by people and probably most were questioned just like this guy.
    I don't get it... so it's a morph that looks exactly like a normal?

  7. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: ??What price??

    I thought I posted this in here but I may be delusional...

    I think you might find this thread enlightening:

    http://ball-pythons.net/forums/showt...t=faded+albino

    I have not researched it much more since then but I stand by the comment that I made in that thread. Basically it is as Joe mentioned above. Only guarantee your snake is a het albino is if it had an albino parent. The agent responsible for the switch from axanthic-looking to normal looking may or may not be tied directly to the albino allele. I have my suspicions but they are just that. I can not find anyone with a solid reputation that has done the necessary work to prove one way or another so I do not think you can guarantee that these silver to brown switchers are 100% hets based on that trait alone.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #18
    Registered User
    Join Date
    02-15-2009
    Location
    alburtis, pa
    Posts
    29
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: ??What price??

    Quote Originally Posted by joepythons View Post
    A little info for you about the "blush albino" snake.Its a line of bull crap just like MKR is.They were proving to be scammers several times over.So it is only a het albino and thats only if you have genetic papers to prove it.If it has MKR sig as them being the breeders then its probably worthless since they never bred one single snake.They bought snakes from others and lied to TONS of people.Sorry if i sound rude here i am just trying to let you know the truth.
    Ok now i know what you meant by the snake. i had no idea that MKR were scammers. But i guess that's a good thing that i didn't get it from them. The breeder is Steve Markevich. he owns serpents den. google it. he's on myspace. he's the one that breed the 100% het albino and the 100% het yellow blush albino. he sold them to my cousin Rory. you can talk to him on myspace and ask him. he also bred this snake.



    ok for some reason the picture didn't come up on the last post. if you can find another snake that looks like this one let me know.
    Last edited by dakotachristy84; 02-17-2009 at 01:35 PM.

  9. #19
    Registered User
    Join Date
    02-15-2009
    Location
    alburtis, pa
    Posts
    29
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: ??What price??

    check out more photo's of the energy ball
    http://www.reptilegeeks.com/forums/d...thon-hatching/

  10. #20
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: ??What price??

    Umm... The Energy Ball is not an albino so I am not sure how it relates to the "blush" albinos we are discussing in this thread ???
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 2 of 7 FirstFirst 1234567 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1