» Site Navigation
2 members and 6,648 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,111
Threads: 249,262
Posts: 2,573,023
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Albino Spiders
Hey,
I was just wondering, what are albino spider genetics? I'm sure they are not as simple as spider x albino.
Thanks,
-
-
Re: Albino Spiders
Yes, it's that simple. One spider het albino and a het albino or 2 spiders het albino will give you a shot at getting that combo.
-
The Following User Says Thank You to Shadera For This Useful Post:
Hock3ymonk3y (02-16-2009)
-
BPnet Veteran
Re: Albino Spiders
This is correct, as far as getting the albino and spider genes into one animal can be a little trickier. This is all because the albino gene is recessive. But a little research and you should be able to figure out how to do so. If you have any more questions on it I can go into detail about how go about getting one and the odds of each pairing.
-
The Following User Says Thank You to Fearless For This Useful Post:
Hock3ymonk3y (02-16-2009)
-
BPnet Veteran
Re: Albino Spiders
 Originally Posted by Fearless
This is correct, as far as getting the albino and spider genes into one animal can be a little trickier. This is all because the albino gene is recessive. But a little research and you should be able to figure out how to do so. If you have any more questions on it I can go into detail about how go about getting one and the odds of each pairing.
If you don't mind, I'm vey curious about this too. What are the chances of getting them and how many possible pairings are there?
MH
Who the hell is Pat?
"Pattimuss doesn't run, he prances most delicately, like a beautiful but sad fairy, winged and capped, curly toed shoes on each foot, dancing on dewdrops while lazy crickets play soft music for him to keep time by...." - Wes
-
-
Registered User
Re: Albino Spiders
Lets say eight eggs hatch
two are spiders and all are het albino.
Take one of the spider het albinos and breed it back to the albino when it's old enough. Hopefully the albino is a female and one of the het spiders would be a male so you could possible breed them the next year.
Out of all the next clutch each egg would have a 50% chance of being spider and 50% chance of beign albino.
I'm thinking in the end it turn out 25% albino, 25% spider het albino, 25% normal het albino, and last but not least 25% spider albino. Anyone know this for sure? I'm prolly wrong lol.
-
-
BPnet Veteran
Re: Albino Spiders
 Originally Posted by DutchHerp
If you don't mind, I'm vey curious about this too. What are the chances of getting them and how many possible pairings are there?
The most efficient way to start would be to breed a male spider to an albino girl, take one of the male spiders (since it will be 100% het) from that clutch and breed it back to the albino female. Giving you 25% albino spiders 25% albinos 25% spiders het albino and 25% het albinos.
If you were to just choose to breed a het albino to a spider het albino, your chances are way reduced of getting an albino spider because your odds are
12.5% albino spider 12.5% albinos 25% spiders het albinos 25% het albinos 12.5% spiders 12.5% normals. All animals not visually displaying the albino gene would be considered 66% possible hets
Does that make sense?
Last edited by Fearless; 02-16-2009 at 01:56 PM.
-
The Following User Says Thank You to Fearless For This Useful Post:
-
Re: Albino Spiders
 Originally Posted by southb
I'm thinking in the end it turn out 25% albino, 25% spider het albino, 25% normal het albino, and last but not least 25% spider albino. Anyone know this for sure? I'm prolly wrong lol.
Yeah, that would be right for an albino bred to a spider het for albino.
Alternatively you could do het albino x spider het albino. That would give you a 1 in 8 chance of hitting the albino spider
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Albino Spiders
And Trevor beat me to it LOL
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Albino Spiders
 Originally Posted by Fearless
This is correct, as far as getting the albino and spider genes into one animal can be a little trickier. This is all because the albino gene is recessive. But a little research and you should be able to figure out how to do so. If you have any more questions on it I can go into detail about how go about getting one and the odds of each pairing.
Thanks for doin that!
-
-
Re: Albino Spiders
Spider het albino X Albino
-
The Following 8 Users Say Thank You to ColinWeaver For This Useful Post:
Dave763 (02-22-2009),dr del (02-17-2009),DutchHerp (02-16-2009),greghall (02-17-2009),Hock3ymonk3y (02-16-2009),Malpaso (02-24-2009),southernboagurl (02-23-2009),Wh00h0069 (02-23-2009)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|