» Site Navigation
1 members and 1,155 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,917
Threads: 249,118
Posts: 2,572,202
Top Poster: JLC (31,651)
Welcome to our newest member, Necbov
|
-
BPnet Veteran
Dart Frog Breeders????
Ok, so I'm in the market for some new darts and am a little too impatient to wait 4 more months for the next show to come around this way.. I have found a few good sites online (Josh's Frogs, In Frog Neato, and Brian's Tropical) that have a pretty good selection and seem to have good guarantees, etc..
My question is: does anyone else have any other sites in mind that you think are a good choice for online dart frog purchases? Any info would be greatly appreciated.
P.S. It would be great if the sites also sold terrarium plants as well so I can kill 2 birds with one stone, but any info will help.....
-
-
Re: Dart Frog Breeders????
Try Black Jungle. They do frogs and plants and vivarium decor items and feeders and...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Dart Frog Breeders????
 Originally Posted by asplundii
Try Black Jungle. They do frogs and plants and vivarium decor items and feeders and...
Thank you, that was the other one I knew of, but couldn't remember the name. It seems like there would be more places out there considering how many people seem to have these little critters... Ha ha.
-
-
Registered User
Re: Dart Frog Breeders????
www.saurian.net great to work with and probly the best quality for your money.
Holy crip, he's a crapple!
1.0 Normal
1.0 Pastel
0.2 Odd
-
-
Re: Dart Frog Breeders????
 Originally Posted by thatkindofgirl
Thank you, that was the other one I knew of, but couldn't remember the name.
No worries 
It seems like there would be more places out there considering how many people seem to have these little critters... Ha ha.
If you ever jump to the DendroBoard you will find that those people do a lot of between themselves swapping. I think that may account for the fewer vendors doing "everything for everybody." But that is just a guess
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Dart Frog Breeders????
dendroboard.net
it's BP.net but for dart frogs. have fun
i got ideas about making rock walls form there. it's a good site
2.0 Normal BP
0.1 Pastel
0.1 Albino Cal King
1.1 Albino ASF
0.0.3 YellowBelly Sliders
1.1 Orange Cats
0.0.2 Goldfish
-
-
Re: Dart Frog Breeders????
 Originally Posted by Ranegyr
i got ideas about making rock walls form there.
I LOVED that thread!!!
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Dart Frog Breeders????
Thanks everyone! I am going to jump on there soon and see what I can find. I appreciate the suggestions, the more options I have, the better...
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|