» Site Navigation
1 members and 750 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,106
Posts: 2,572,115
Top Poster: JLC (31,651)
|
-
Registered User
what do you think about carpet pythons
what are they like are they friendly? Are they strikers? are they easy to care for
Bobby
2.1 norm balls
1.0 squirrel
2.2 turtles
0.0.3 whites tree frogs
0.1 leopard gecko
1.1 box turtles
and some fish
-
-
Re: what do you think about carpet pythons
Well they are an order of magnitude more energetic than a ball 
They can be nippy as youngins but with work they are big babies. Very curious. And if they are all like mine then they have a slightly unnerving habit of looking you right in the eye...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: what do you think about carpet pythons
im thinkin about gettin one i really like the jag carpet
Bobby
2.1 norm balls
1.0 squirrel
2.2 turtles
0.0.3 whites tree frogs
0.1 leopard gecko
1.1 box turtles
and some fish
-
-
BPnet Veteran
Re: what do you think about carpet pythons
Carpets are great. They will probably bite you if you get a baby but holding it will help. They grow into lap dogs usually. Jags are supposidly one of the more agressive morphs just because of all the genetics going into it IMO. Doing research on which jag you want will help you too. There are coastal (the original) Irian Jaya, Jungle, and bredli jags. Also jagpondros!
Chondro-holic
 Originally Posted by DutchHerp
Yeap, it's official.
David is the official BP.net Morelia-picture-taker-putter-on-the-internet-er!
-
-
BPnet Veteran
Re: what do you think about carpet pythons
I love my buddy's (python guy) Jungle CP. Curious snakes, I actually have a facebook pic where his went down my shirt, wrapped around my body, and poked his head out of the back. PM him if this may be what you are wanting.
Steffen, pronounced with f's, not v's
1.0 Normal BP, Oakley; 0.1 Normal BP, Hissy Fit; 1.0 Savannah Monitor, Abraxas, RIP 2-1-09; 0.0.1 Pacman Frog, Twoey; 1.0 BCI/BCC Cross, Quetzalcoatl "Q"; 0.0.1 Crestie - Flametail; 0.0.1 Crestie - Nuala; 0.1 Emp Scorpion - Black Arachnia; 0.1 ATB - Cortana; 0.0.1 Savvy - Lohe; 0.1 Colombian RTB, Queen Zida; 1.0 Common Boa; 0.0.1 Beardie
-
-
BPnet Veteran
Re: what do you think about carpet pythons
I only have one carpet, and I got him as an adult, so I'm by no means experienced like some of these guys.
My guy has never bitten me, but hisses 80% of the time. Sometimes he just roams around my room for a long time, and then he just goes back in. Great snakes!
And yeah, mine always looks me in the eyes!
MH
Who the hell is Pat?
"Pattimuss doesn't run, he prances most delicately, like a beautiful but sad fairy, winged and capped, curly toed shoes on each foot, dancing on dewdrops while lazy crickets play soft music for him to keep time by...." - Wes
-
-
BPnet Veteran
Re: what do you think about carpet pythons
 Originally Posted by DavidG
Jags are supposidly one of the more agressive morphs just because of all the genetics going into it IMO.
i don't know where you get that from... if anything, tigers have a bad rep.
if anything, jags are the most laid back of any carpet. they are very gentle, slower and not as 'athletic' as normal carpets in general.
if you are familiar with balls, think of jag in terms of spider balls.
Colin Vestrand
long time keeper and breeder of carpet pythons and other snakes...
-
-
BPnet Veteran
Re: what do you think about carpet pythons
Im lovin the super zebra!!!
-
-
Registered User
Re: what do you think about carpet pythons
I got my jcp a little over a month ago as a juvinile he has way more energy than my ball and the whole lookin in the eye thing that kinda freaked me out in the begining but all and all a pretty good snake so far.
-
-
BPnet Veteran
Re: what do you think about carpet pythons
Well, we have 4 total (2 IJ's, 1 coastal, and 1 jungle) and I think they are all great.... I have to agree, they can be a tad bit nippy as babies, but with some work they tame out pretty easy.. They are very curious and VERY visual, everytime I walk in the room the JCP watches every move I make!! And, I do have to agree, they do seem to stare you right in the eyes, very neat...
Here is a teaser of the ones we have. Sorry, I'm just bein' a proud momma!!!



Last edited by thatkindofgirl; 02-15-2009 at 12:14 AM.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|