» Site Navigation
0 members and 1,333 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,937
Threads: 249,129
Posts: 2,572,287
Top Poster: JLC (31,651)
|
-
Registered User
woma lessers
ok so I personally think these are some of the most beautiful BPs around for being two completely different looking morphs. I keep hearing this and that about "hidden gene womas" blah blah blah. Technically speaking, if all womas have the same genes, (because they ARE womas, like a spider would have genes for being a spider, at least visually speaking) couldn't you just take any ol' woma and any ol' lesser and make one? Or am I missing something?
-
-
Re: woma lessers
You are missing something 
There appear to be 2 distinct populations of woma morph in captivity. Both of them have the "woma gene" but only one of them carries an additional gene, the so called "hidden" gene. As far as I know only NERD offers hidden gene woma
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Registered User
Re: woma lessers
 Originally Posted by asplundii
You are missing something
There appear to be 2 distinct populations of woma morph in captivity. Both of them have the "woma gene" but only one of them carries an additional gene, the so called "hidden" gene. As far as I know only NERD offers hidden gene woma
Ah...I see so if I wanted to do this I guess I should go to NERD then...damn...Thanks though!
-
-
Registered User
Re: woma lessers
you need hidden gene from both parents for a soul sucker. so you need a hidden gene carrier woma and a hidden gene carrier lesser.
even then there is a 1/16 chance of hitting the soul sucker. i think it works as a 1/4 chance, being as you have 1/4 chance of a woma lesser it would be 1/16 for a soul sucker wouldnt it? with it needing the woma lesser and 2 copies of the hidden gene?
-
-
BPnet Veteran
Re: woma lessers
Isnt the woma's hidden trait what created the "pearl"? Just curious, i know i have asked this before, but i have a horrible memory
-
-
BPnet Veteran
-
-
BPnet Veteran
You know you're into reptiles when...
" You tell people on the phone 'I can't talk now, I've got a lizard on my head!!!' " (NERD) 
-
-
Registered User
Re: woma lessers
 Originally Posted by juddb
Isnt the woma's hidden trait what created the "pearl"? Just curious, i know i have asked this before, but i have a horrible memory 
yeah, it's a pretty snake but I hear that they have some kind of genetic defects and they don't really thrive.
-
-
BPnet Veteran
Re: woma lessers
 Originally Posted by joshthaxton
yeah, it's a pretty snake but I hear that they have some kind of genetic defects and they don't really thrive.
Im not positive but i think only one was produced and died early on.
-
-
BPnet Veteran
Re: woma lessers
Yea woma lessers are really nice. NERD has the nicest i've seen though, check them out on this NERD page:
http://www.newenglandreptile.com/ner...ll-python.html
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|