Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 580

2 members and 578 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,200
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 1 of 3 123 LastLast
Results 1 to 10 of 24
  1. #1
    Anti-Thread Necro Patrol
    Join Date
    05-10-2007
    Location
    Columbus, Georgia, United States
    Posts
    4,561
    Thanks
    334
    Thanked 1,230 Times in 739 Posts
    Blog Entries
    1
    Images: 51

    Ralph Davis - Ball Python Setup

    Part 1
    YouTube - Basic Ball Python Set-Up ( part 1 )
    Part 2
    YouTube - Basic Ball Python Set-Up ( part 2 )

    Not what I expected. Kinda contradicts a lot of the info on this site. What do you guys think?

  2. #2
    BPnet Veteran starmom's Avatar
    Join Date
    12-08-2007
    Location
    Oregon
    Posts
    5,194
    Thanks
    147
    Thanked 291 Times in 251 Posts

    Re: Ralph Davis - Ball Python Setup

    I think that if i employed the generic set-up, my snake would either die of the cold or shrivel up due to extremely low humidity!!

    My house is cold, where I live is cold, and the relative humidity outside is typically about 25-285 year round and so much drier in the house due to the heater being on!

    Generic, in this case, would only work well if you lived in a warmer and more humid environment


    ~~McKinsey~~
    "Men have forgotten this truth," said the fox. "But you must not forget it. You become responsible, forever, for what you have tamed."
    ~The Little Prince; Antoine de Saint Exupery

  3. #3
    BPnet Veteran brainman1000's Avatar
    Join Date
    03-21-2006
    Location
    Las Vegas
    Posts
    362
    Thanks
    5
    Thanked 25 Times in 22 Posts
    Images: 4

    Re: Ralph Davis - Ball Python Setup

    Quote Originally Posted by MasonC2K View Post
    Kinda contradicts a lot of the info on this site. What do you guys think?
    There isn't just one correct way to house a ball python. There are a few basics and then the rest is all personal preference.

  4. The Following User Says Thank You to brainman1000 For This Useful Post:

    RichardA (02-06-2009)

  5. #4
    BPnet Lifer Nate's Avatar
    Join Date
    07-31-2004
    Location
    Northern Virginia
    Posts
    9,863
    Thanks
    127
    Thanked 625 Times in 386 Posts
    Images: 15

    Re: Ralph Davis - Ball Python Setup

    Quote Originally Posted by brainman1000 View Post
    There isn't just one correct way to house a ball python. There are a few basics and then the rest is all personal preference.
    Yes!

    Great videos. Great tips. It's always helpful to see someone set it up.

    Yes, some of the info is contrary, but it's not wrong. It's just another method.

  6. The Following User Says Thank You to Nate For This Useful Post:

    RichardA (02-06-2009)

  7. #5
    Registered User JKExotics's Avatar
    Join Date
    01-06-2009
    Location
    New York
    Posts
    149
    Thanks
    1
    Thanked 24 Times in 17 Posts

    Re: Ralph Davis - Ball Python Setup

    Ralph knows what he's talking about and honestly it's not a bad setup, personally I'd change a few things but all in all it's not bad at all. Simple and easy to clean for a tank, I think that's where he was going with this.


  8. #6
    Broken down old dude dsirkle's Avatar
    Join Date
    09-15-2007
    Location
    Plymouth Twp Michigan
    Posts
    4,745
    Thanks
    481
    Thanked 988 Times in 649 Posts
    Images: 31

    Re: Ralph Davis - Ball Python Setup

    Quote Originally Posted by starmom View Post
    I think that if i employed the generic set-up, my snake would either die of the cold or shrivel up due to extremely low humidity!!

    My house is cold, where I live is cold, and the relative humidity outside is typically about 25-285 year round and so much drier in the house due to the heater being on!

    Generic, in this case, would only work well if you lived in a warmer and more humid environment
    I agree that things are different in a cold climate vs a warm climate.That wouldn't be the ideal set up for me either. Ralph and his friend are in Florida though. Where I live temps have been below freezing for a good while and down around 0 degrees at night for weeks. I keep my house at 65 degrees, but have an electric heater in my herp room. While I like pvc type cages and racks myself, I can well understand how the price of a glass enclosure might look like the way to go for anyone.
    Do not resuscitate

  9. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Ralph Davis - Ball Python Setup

    Quote Originally Posted by dsirkle View Post
    Ralph and his friend are in Florida though.
    Um... Unless I am going nuts, Ralph is in Maryland...

    http://www.ralphdavisreptiles.com/contact_me/
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. The Following User Says Thank You to asplundii For This Useful Post:

    dsirkle (01-27-2009)

  11. #8
    Anti-Thread Necro Patrol
    Join Date
    05-10-2007
    Location
    Columbus, Georgia, United States
    Posts
    4,561
    Thanks
    334
    Thanked 1,230 Times in 739 Posts
    Blog Entries
    1
    Images: 51

    Re: Ralph Davis - Ball Python Setup

    Please no one take this personally. This is just a an observation of mine.

    I have seen a lot of posts on these forums from new people who post pictures of similar set ups and get absolutely ripped to shreds for it. I can almost guarantee that if a joe blow that no one knew had posted a video like this that I would have seen the following:

    "You need two identical hides."
    "Those stick on thermometers are terrible. And there's no humidity guage! Please use an Accurite!"
    "Those UTH's get up to 120 degrees and fluctuate wildly. You have to use a rheostat/thermostat!"
    "Please cover the sides of the tank with a dark material."

    From my perspective, it appears there's a double standard.

    Maybe my perspective is skewed but that's how I see it. Am I wrong?

  12. The Following 11 Users Say Thank You to MasonC2K For This Useful Post:

    + Show/Hide list of the thanked

    DarkComeSoon (09-07-2009),DutchHerp (01-27-2009),grammie (01-27-2009),grunt_11b (01-31-2009),JohnNJ (01-27-2009),joshthaxton (02-05-2009),Kaorte (01-31-2009),mdjudson (01-27-2009),Mischke (01-31-2009),scutechute (01-27-2009),zhang317 (01-31-2009)

  13. #9
    BPnet Veteran Dave763's Avatar
    Join Date
    01-08-2008
    Location
    Fairport NY
    Posts
    604
    Thanks
    45
    Thanked 109 Times in 78 Posts
    Images: 4

    Re: Ralph Davis - Ball Python Setup

    Looks good to me, 'cept... I'd lose the lamp, get a thermometer, and start with a 20 long tank instead of a ten. I'd cover part of the screen top to help hold in humidity(its very dry here in the winter) Newspaper is great, I hate the green carpet. Aspen would work and look nicer.
    I'm not sure I would trust a UTH without a way to regulate it, (rheostat or a thermostat) I love Helix but they are a bit pricey.

  14. #10
    BPnet Veteran Dave763's Avatar
    Join Date
    01-08-2008
    Location
    Fairport NY
    Posts
    604
    Thanks
    45
    Thanked 109 Times in 78 Posts
    Images: 4

    Re: Ralph Davis - Ball Python Setup

    Quote Originally Posted by MasonC2K View Post
    Please no one take this personally. This is just a an observation of mine.

    I have seen a lot of posts on these forums from new people who post pictures of similar set ups and get absolutely ripped to shreds for it. I can almost guarantee that if a joe blow that no one knew had posted a video like this that I would have seen the following:

    "You need two identical hides."
    "Those stick on thermometers are terrible. And there's no humidity guage! Please use an Accurite!"
    "Those UTH's get up to 120 degrees and fluctuate wildly. You have to use a rheostat/thermostat!"
    "Please cover the sides of the tank with a dark material."

    From my perspective, it appears there's a double standard.

    Maybe my perspective is skewed but that's how I see it. Am I wrong?
    It's easy to rip on Joe Blow(the poor guy). I think Ralph knows his stuff and is suggesting a "bare bones" setup for a person starting out with their first ball python.

Page 1 of 3 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1