» Site Navigation
0 members and 646 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,104
Posts: 2,572,100
Top Poster: JLC (31,651)
|
-
Re: Have you ever seen this before???
That's definitely something different. I guess I'd lean towards it being an injury also, I guess we'll just have to see if it heals or not. It's really odd how evenly spaced out the holes are though. I've certainly never seen anything like it.
-
-
BPnet Veteran
Re: Have you ever seen this before???
Yes, I have seen this before. I saw it yesterday at your place. hehe..
I saw this at a glance and it looked like some type of rat bite. However, when I took a closer look it was not an injury. Though the indents on the left could pass as a wound it actually seemed like merged pits (if that is what they are) while the pits on the right were more separated.
Congrats on the new morph - Plentypit Ball or Pittyfull Ball or P. Pitty hehehe
All you have to do is prove it out now... =)
Joseph
Hyper Reptilia
"Where our reptiles come first"
-
-
Re: Have you ever seen this before???
 Originally Posted by Hyper Joe
Yes, I have seen this before. I saw it yesterday at your place. hehe..
I saw this at a glance and it looked like some type of rat bite. However, when I took a closer look it was not an injury. Though the indents on the left could pass as a wound it actually seemed like merged pits (if that is what they are) while the pits on the right were more separated.
Congrats on the new morph - Plentypit Ball or Pittyfull Ball or P. Pitty hehehe
All you have to do is prove it out now... =)
At first glance it does look like teeth marks, but then you realize that it curves the wrong way to be that. Pretty interesting.
-
-
Re: Have you ever seen this before???
Flesh eating bacteria similar to those that cause cavities? ~_~
I got nothin...
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
-
BPnet Veteran
Re: Have you ever seen this before???
Those are the craziest things I've ever seen, I hope she's ok. Maybe it's some type of new bp species and you can prove it out.
-
-
Re: Have you ever seen this before???
They seem too perfectly placed on both sides to be an injury, it's fairly symmetrical. Could it be some kind of a birth defect possibly? Somehow some cells got mixed signals in the egg? Kinda neat to look at though.
-
-
Re: Have you ever seen this before???
It is hard to tell from the pic but are the back lower lip pits normal?
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Have you ever seen this before???
Out of curiosity, what's the inside of her mouth look like? The choana area normal?
-
-
BPnet Veteran
Re: Have you ever seen this before???
wow.. thats interesting. perhaps it was supposed to be a twin and the one twin was reabsorbed in the egg but not before extra heat pits were "programmed"? yeah probably a shot in the dark with my theory but hey, anything is possible. Keep us posted on her progress Heather.
-
-
Re: Have you ever seen this before???
At first glace it looked like she bit herself, but the holes are too big.
Is she a Teen? Because you need to go look into her cage and see if you see any ring piercings ( What would these be called, Snake bites?)
- Matt
Come here little guy. You're awfully cute and fluffy but unfortunately for you, you're made of meat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|