Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

> FAQ

» Online Users: 689

0 members and 689 guests

No Members online

Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,112
Posts: 2,572,162
Top Poster: JLC (31,651)

Welcome to our newest member, KoreyBuchanan

Results 1 to 3 of 3

Thread: Are Closeups a bad thing?

Thread Tools
- Show Printable Version
Display
- Switch to Linear Mode
- Switch to Hybrid Mode
- Threaded Mode

Threaded View

Previous Post

Next Post

01-13-2009, 11:38 AM #2
asplundii

View Profile

View Forum Posts

View Blog Entries

View Gallery Uploads
BPnet Veteran

Join Date

10-17-2008

Posts

906

Thanks

103

Thanked 722 Times in 382 Posts
Re: Are Closeups a bad thing?

Well when I am doing close ups I am usually in macro mode so no flash involved...

actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
Reply With Quote

Quick Navigation BP Pictures Top

« Previous Thread | Next Thread »

Posting Permissions

You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
[VIDEO] code is On
HTML code is Off

Powered by vBadvanced CMPS v4.2.1

All times are GMT -4. The time now is 07:49 PM.

Copyright © 2003-2025 Ball-Pythons.net. All Rights Reserved.