» Site Navigation
0 members and 1,106 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,065
Threads: 249,215
Posts: 2,572,767
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: BAD news Georgia... :( ASF's BANNED
 Originally Posted by AaronP
"Normal" Rats aren't even normal rats, they're from the Netherlands...
Rats originated from China/Mongolia.
"If I were stranded on a desert island and could only have one book, record and person...I'd probably die of exposure."
czphotography
-
-
Re: BAD news Georgia... :( ASF's BANNED
 Originally Posted by West Coast Jungle
They are also illegal like many other animals (ferrets, gerbils) in Cali but people still have them.
See what I don't get is that Gerbils are legal in GA...how are they that much more different from ASFs.
-
-
Re: BAD news Georgia... :( ASF's BANNED
 Originally Posted by AaronP
See what I don't get is that Gerbils are legal in GA...how are they that much more different from ASFs.
ASF's have the word "African" in their name. That is the difference.
Mikey Cavanaugh
(904) 318-3333
-
-
Re: BAD news Georgia... :( ASF's BANNED
 Originally Posted by AaronP
See what I don't get is that Gerbils are legal in GA...how are they that much more different from ASFs.
ASF's are a different genus and species and are also not a native species to Georgia. Gerbils being from very arid environments.
ASF's are also a natural vector for a zoonotic disease called Lassa Fever and the Plague. They are a plague unto themselves during flooding season and cause millions of damage to any crop in sub sahara Africa.
-
-
Re: BAD news Georgia... :( ASF's BANNED
Gerbils can cary plague too. And arenaviruses for that matter. All flea bearing animal (for the prior) and rodents (for the latter) can. So those are sort of a weak arguments for banning them.
Plus, plague is in the US in a number of other, much closer to home animals (prairie dogs, ground squirrels, tree squirrels, skinks, racoons, cats...) so if you are going to worry about catching it you have sources close to home to worry about
And none of the serious human disease causing arenaviruses are in the US so it is not like CBB ones are going to suddenly introduce them in the wild here... The implication that CBB ASF would spread Lassa is kind of like saying a CBB lab monkey could spread Ebola. Ridiculous
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: BAD news Georgia... :( ASF's BANNED
Hi all,
I thought I would post something to clear up any confusion.
ASF rats were not banned recently. The law that prohibited these and other exotic rodents from being held in Georgia without a license went into effect sometime in the early 1980's.
We have not just decided to 'crack down' on these rats either. Simply, I was not aware that they were being sold in Georgia. I was planning to go to Repticon this weekend and did a web search to find the hours. That web search also picked up Mr. Cavanaugh's posting on another forum. That posting stated he was bringing these rats up to Repticon from Florida. Rather than see Mr. Cavanaugh be embarrassed or waste his time bringing live animals to Georgia that he could not sell, I thought it the gentlemanly thing to do to give him a heads up before he got here.
He then asked me to speak with Mr. Cardell. After speaking with Mr. Cardell by phone I thought there might be more people in Georgia with these rats so I did another web search and found two other individuals. I called one and had a pleasant conversation and emailed the other (based on his responses here I think the conversation would not have been pleasant).
My intent was not to make some knee-jerk decision. My intent was to let an out of state dealer know that it would not be lawful for him to bring a prohibited animal to a show in Georgia that would have DNR law enforcement in attendance.
The law governing these animals is the Wild Animals Law, Title 27, Chapter 5 of the Official Code of Georgia. The legislature states in 27-5-1 why they thought this law important.
§ 27-5-1. Legislative intent and findings
The General Assembly finds and declares that it is in the public interest to ensure the public health, safety, and welfare by strictly regulating in this state the importation, transportation, sale, transfer, and possession of those wild animals which pose a possibility of:
(1) Harmful competition for wildlife;
(2) The introduction of a disease or pest harmful to wildlife;
(3) Problems of enforcing laws and regulations relative to wildlife;
(4) Threatening wildlife or other natural resources; or
(5) Endangering the physical safety of human beings.
The importation, transportation, sale, transfer, and possession of wild animals are privileges not to be granted unless it can be clearly demonstrated that such actions can be accomplished in a manner that does not pose unnecessary risk to Georgia's wildlife and other natural resources or to the citizens of and visitors to this state. For these reasons, the General Assembly further finds and declares that only certain wild animals may be held for scientific or educational purposes, for public exhibition, or as pets and may only be lawfully held when the requirements of this chapter are met. The General Assembly further finds and declares that any wild animal for which a license or permit, or both, is required under the provisions of this chapter and for which no such license or permit, or both, has been obtained is a nuisance and is contraband and is subject to seizure by any peace officer authorized to enforce this chapter.
There is a wild animal license available to Georgia residents that allows them to possess these rats lawfully in Georgia. This license permits the out-of-state sale of live rats. For more information please see our webpage:
Permits and other services
If you have any questions please feel free to call or email.
Todd N. Nims
Wildlife Biologist - Special Permit Unit
Georgia Wildlife Resources Division
2065 US Hwy 278 SE
Social Circle, GA 30025
(770) 761-3044
(706) 557-3060 (fax)
todd.nims@dnr.state.ga.us
-
The Following 6 Users Say Thank You to Todd Nims For This Useful Post:
cassandra (01-09-2009),dr del (01-10-2009),grammie (01-09-2009),littleindiangirl (01-09-2009),Mike Cavanaugh (01-12-2009),Oxylepy (07-31-2010)
-
Registered User
Re: BAD news Georgia... :( ASF's BANNED
 Originally Posted by asplundii
GA has some really silly laws on animals. A few years back my sister-in-law was trying to find a home for an unwanted sugar glider so I was looking into care and learned they were not legal here. I called a few places to see if there were any exceptions to this and asked why exactly they were not legal to keep. I was told (and this is where it gets funny) that sugar gliders were illegal to keep because there was a law stating no marsupials could be kept and that that law originated during the Depression to keep people from raising opposum as a food source... I guess the "no native animals" law was not enough to stop people from eating opposum so they had to add the "no marsupials" law as well. How stupid is that?
I am not sure who told you this but their information is not even remotely accurate. The laws dealing with native opossums are in a completely different chapter from the laws dealing with exotic marsupials.
-
The Following 2 Users Say Thank You to Todd Nims For This Useful Post:
asplundii (01-12-2009),Oxylepy (07-31-2010)
-
Re: BAD news Georgia... :( ASF's BANNED
 Originally Posted by asplundii
Gerbils can cary plague too. And arenaviruses for that matter. All flea bearing animal (for the prior) and rodents (for the latter) can. So those are sort of a weak arguments for banning them.
Plus, plague is in the US in a number of other, much closer to home animals (prairie dogs, ground squirrels, tree squirrels, skinks, racoons, cats...) so if you are going to worry about catching it you have sources close to home to worry about
And none of the serious human disease causing arenaviruses are in the US so it is not like CBB ones are going to suddenly introduce them in the wild here... The implication that CBB ASF would spread Lassa is kind of like saying a CBB lab monkey could spread Ebola. Ridiculous
The ASF are (in 1975) speculated as being the only other natural vectors for the for the arenavirus for Lassa Fever; they also rarely show clinical signs... But to say that an ASF would never come into contact with the excrement's of the most populace rodent in Africa is a little under rated. How many ball pythons are imported annually? And how many keepers have ASF's?
I would speculate the chance is definitely there for reinfection in captive populations. Although the clinical signs in humans from handling the infected imported objects (boxes, bags etc) would show long before the spread of the disease in captive populations is noticed.
Although slim as it may be, I'm just keeping it out there. 
Your correct that the parasites on them can carry the plague, I'm just stating why they were banned from importation in the 80's. Plague was listed as the other reason because of the epidemics that still happen in Africa.
http://www.itg.be/itg/DistanceLearni...avirusesp4.htm
http://www.ajtmh.org/cgi/content/abstract/27/3/627
http://www.ajtmh.org/cgi/content/full/77/1/169
The other stipulation for banning of ASF is the main reason people breed them in captivity. They have a high average for pups in a litter, which is (dont remember the exact numbers off the top of my head) higher by quite a bit than other rodent species. They have almost 24 teats per female, and generally have a huge population explosion during the flood/ crop season, and Georgia frankly has gorgeous weather and geography, these animals would thrive.
I think the fear of population explosions and crop damage is the main reasoning to not allow the asf's in captivity in many southern or western states. People are scared and don't want to deal with yet another rodent pest, especially one that reproduces so quickly and with such little territorial instinct, that it would rather live side by side other rodent species, more so than other rodent species will tolerate.
http://www.jstor.org/pss/2559240
(I quoted this bit because the page is only cached for me, link doesnt work properly)
http://74.125.77.132/search?q=cache:...ient=firefox-a
The multunammate rat, Praomys (Mastomys) natalensis
This species is economically the most important rodent pest in Africa, and a true indigenous commensal (Fiedler 1988). In many areas it may be replaced by the much larger R. rattus.
The fur is soft, brownish on the back and greyish underneath. The head+body length is up to 150 mm, and the fully grown adult weight is 50-100 g. The tail, which is uniformly dark, is about the same length as the head+body.
Most distinctively, the female has up to 24 nipples on her belly (other rat species rarely have more than 10) and the reproductive potential is high, particularly since this species lives in large social groups. Consequently, very large population explosions occur from time to time, causing huge losses.
Last edited by littleindiangirl; 01-09-2009 at 03:24 PM.
-
-
Registered User
Re: BAD news Georgia... :( ASF's BANNED
Thanks Todd, for presenting that in a very nice manner. I checked into the license, but can't see paying the fee for the one animal on the list I would keep. I'll just move to rats.
-
-
BPnet Veteran
Re: BAD news Georgia... :( ASF's BANNED
 Originally Posted by Todd Nims
I called one and had a pleasant conversation and emailed the other (based on his responses here I think the conversation would not have been pleasant).
Mr. Nims,
I wasn't trying to sound like a butt. I was just making kind of a "HAHA" matter out of it. I'm not saying this is a joking matter by any means.
I killed off most of my ASF a long time ago. The ads you found were a few months old. I have now removed them. I may have missed some but I no longer sell ASF Rats.
I'm a simple person and a nice guy (ask anyone that knows me). Feel free you call me up anytime. It would be pleasant. Not to say I agree with you or most of the laws on the books.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|