Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 468

0 members and 468 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,086
Threads: 249,226
Posts: 2,572,838
Top Poster: JLC (31,651)
Welcome to our newest member, diingoo
Page 4 of 6 FirstFirst 123456 LastLast
Results 31 to 40 of 51
  1. #31
    Registered User Typical_08's Avatar
    Join Date
    12-15-2008
    Location
    NC
    Posts
    251
    Thanks
    53
    Thanked 36 Times in 29 Posts
    Images: 3

    Re: about to make the dreadful switch :tears:

    Quote Originally Posted by SnM_Man View Post
    im fairly new to BP husbandry aswell ... and after seeing some pics of half eaten snakes ... i will never ever leave a live prey in a cage unsupervised ... and also to note that u should feed ur live mice/rats cat or dog food, it contain a food colouring agent that is poisonous ... i forget the name of it but im sure someone else does.
    If it is poisonous to mice, then it would likely be poisonous to dogs and cats as well.

  2. #32
    BPnet Veteran Melicious's Avatar
    Join Date
    03-29-2006
    Location
    Fairfax, Virginia; Originally from San Antonio, Texas.
    Posts
    2,135
    Thanks
    120
    Thanked 236 Times in 207 Posts
    Images: 12

    Re: about to make the dreadful switch :tears:

    Quote Originally Posted by SnM_Man View Post
    im fairly new to BP husbandry aswell ... and after seeing some pics of half eaten snakes ... i will never ever leave a live prey in a cage unsupervised ... and also to note that u should feed ur live mice/rats cat or dog food, it contain a food colouring agent that is poisonous ... i forget the name of it but im sure someone else does.
    You're learning already. Good. -Smiles.- Feeding live can be safe and enjoyable(I enjoy seeing the feeding response very much) as well as feeding frozen/thawed. You just have to be THERE to observe your snake. Plain and simple.
    Melanie Ryan Seals

    2.2 Royal Pythons; Hadrian(het. albino), Lucius(het. hypo), Ophelia(normal) and Regan(het. albino).
    1.0 Homo sapien boyfriendidus; Nick AKA Daddy.s




  3. #33
    Registered User
    Join Date
    11-14-2008
    Posts
    218
    Thanks
    7
    Thanked 6 Times in 6 Posts
    Images: 2

    Re: about to make the dreadful switch :tears:

    Quote Originally Posted by Typical_08 View Post
    If it is poisonous to mice, then it would likely be poisonous to dogs and cats as well.
    i miss typed ... its fine for the mice but really bad for the snake !!

  4. #34
    BPnet Veteran Texas Dan's Avatar
    Join Date
    02-19-2008
    Location
    Dallas, TX
    Posts
    836
    Thanks
    12
    Thanked 24 Times in 16 Posts
    Images: 2

    Re: about to make the dreadful switch :tears:

    Quote Originally Posted by SnM_Man View Post
    how can u condone feedin in the tank ??... if u have loose substrate u run the risk of impaction


    its not nessecerly whats best for the snake ... but how big my wallet is ..... but shes in a 10 gallon glass tank- with 2 hides n good size water dish - ... shes only maybe 24'' long now, im planing on making a custom enclosure in the near future.
    What? No way. I feed both snakes live, in the tank, with aspen. Never a problem. Rat bones are way tougher than some aspen substrate. I don't think this would ever be an issue if you use the right substrate.
    1.0.0 Normal BP: Vincent Vega

  5. #35
    Steel Magnolia rabernet's Avatar
    Join Date
    07-12-2005
    Location
    In the Nest
    Posts
    29,196
    Thanks
    2,845
    Thanked 5,584 Times in 3,092 Posts
    Images: 46
    Blog Entries
    2

    Re: about to make the dreadful switch :tears:

    Quote Originally Posted by SnM_Man View Post
    im fairly new to BP husbandry aswell ... and after seeing some pics of half eaten snakes ... i will never ever leave a live prey in a cage unsupervised ... and also to note that u should feed ur live mice/rats cat or dog food, it contain a food colouring agent that is poisonous ... i forget the name of it but im sure someone else does.
    With the feeding response of my snakes, the mouse wouldn't get a chance to eat the kibble. Given the choice between the mouse eating kibble or eating the snake, I'd choose kibble. If your snake hasn't eaten him before he has a chance to hunker down and eat the kibble, he's not going to eat him anyway.

    The pictures that you've seen of half eaten snakes are from a keeper leaving a rodent in the enclosure for DAYS at a time, not from a normal live feeding. The anti-live supporters often use them to sensationalize why you shouldn't feed live. A rodent being constricted isn't able to do the damage that is shown in those pictures while it's gasping to take a breath. That's more of an FYI - those pictures horrified me as well - until I was told the true story behind them. Well, it's still horrifying, but not a result of someone feeding their snake live, but rather as a result of irresponsible snake keeping.

  6. The Following User Says Thank You to rabernet For This Useful Post:

    Melicious (01-07-2009)

  7. #36
    BPnet Veteran starmom's Avatar
    Join Date
    12-08-2007
    Location
    Oregon
    Posts
    5,194
    Thanks
    147
    Thanked 291 Times in 251 Posts

    Re: about to make the dreadful switch :tears:

    So true Robin.
    My hypo has already caught and constricted the mouse before I even get the tub drawer closed!!! (That's where pre-scenting works wonders; she knows what's coming )


    ~~McKinsey~~
    "Men have forgotten this truth," said the fox. "But you must not forget it. You become responsible, forever, for what you have tamed."
    ~The Little Prince; Antoine de Saint Exupery

  8. #37
    Registered User
    Join Date
    11-14-2008
    Posts
    218
    Thanks
    7
    Thanked 6 Times in 6 Posts
    Images: 2

    Re: about to make the dreadful switch :tears:

    Quote Originally Posted by Skoalbasher View Post
    What? No way. I feed both snakes live, in the tank, with aspen. Never a problem. Rat bones are way tougher than some aspen substrate. I don't think this would ever be an issue if you use the right substrate.
    ya but the bones come in a wrapped up package that is fairly well stream lined ... and once the prey item makes it to the stomach they remain there untill fully digested ...a random chunck of aspen travelling down the snakes digestive track with its jagged edges could most definatly get caught up and cause some serious side effects ....

  9. #38
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Images: 6
    Blog Entries
    1

    Re: about to make the dreadful switch :tears:

    Here are some tips to feed live

    Pre-scent the room

    Supervise feeding

    Feed smaller preys, feeding a small rats (4 weeks old – 65-85 grams) not only is enough for an adult but it will also reduce the risk of injury

    Remove the prey if not eaten within 20 minutes.

    Do not stun or abuse the prey prior to feeding (This is pretty common sense but obviously not for everyone )

    I feed over live 150 preys each months and none of my snakes ever sustained any injury.
    Deborah Stewart


  10. #39
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: about to make the dreadful switch :tears:

    Quote Originally Posted by rabernet View Post
    There is no one in the wild making sure that snakes aren't consuming leaf litter and twigs.
    Thank you for making that point and saving me from having to.

    I have fed many many snakes over the years on cypress and eco-earth/peat mixes and they are more than capable of ingesting and passing a small amount of the stuff. It would take a huge amount of eco-earth to cause an impaction, significantly more than the very minor amount that may accidentally be taken up by a mis-strike.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. #40
    Steel Magnolia rabernet's Avatar
    Join Date
    07-12-2005
    Location
    In the Nest
    Posts
    29,196
    Thanks
    2,845
    Thanked 5,584 Times in 3,092 Posts
    Images: 46
    Blog Entries
    2

    Re: about to make the dreadful switch :tears:

    Quote Originally Posted by SnM_Man View Post
    ya but the bones come in a wrapped up package that is fairly well stream lined ... and once the prey item makes it to the stomach they remain there untill fully digested ...a random chunck of aspen travelling down the snakes digestive track with its jagged edges could most definatly get caught up and cause some serious side effects ....
    You're overthinking things. First, I'm not sure what type of aspen you're using, but none of the kind I've every used has had random chunks in them. Secondly, breeders have been feeding on cypress mulch (that DOES have chunks in them) for YEARS with no ill effects. Can you name anyone who has actually had an injury as a result of feeding on substrate?

    My point is - people sensationalize "what if" scenarios, and yet no one seems to know first hand someone that it's happened to.

    If F/T is more convenient for you - then use F/T.

    The people responding here are giving you common sense answers to your other options and shared their REAL LIFE experiences doing so. I've fed over 4000 live prey items in the last 4 years to multiple snakes, on many different types of bedding. I've not had a single injury, I've not had any impactions, no one has keeled over from eating a rodent that may have chowed down on dog kibble.

    Fearing the worst outcome, when the best outcome is your more likely outcome seems exhausting to me.

  12. The Following 4 Users Say Thank You to rabernet For This Useful Post:

    hoax (01-08-2009),Melicious (01-07-2009),vgibbens (01-07-2009),wax32 (01-07-2009)

Page 4 of 6 FirstFirst 123456 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1