Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 629

1 members and 628 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 3 of 5 FirstFirst 12345 LastLast
Results 21 to 30 of 44
  1. #21
    Registered User grammie's Avatar
    Join Date
    11-12-2008
    Location
    in the empty nest
    Posts
    321
    Thanks
    157
    Thanked 40 Times in 33 Posts
    Images: 10

    Re: Repticon, near Atlanta Jan, anyone coming?

    only a few more days!!!!!!!!!!

  2. #22
    Registered User mcbrayerreptiles's Avatar
    Join Date
    01-04-2008
    Location
    Carthage NC
    Posts
    121
    Thanks
    1
    Thanked 4 Times in 4 Posts

    Re: Repticon, near Atlanta Jan, anyone coming?

    Last Minute NEWS!!!
    Me and Chris From BA Reptiles will be tableing at the show this weekend!! Please stop by and introduce yourselves...I always like meeting fellow BP Neters.....Come see us!!
    Justin McBrayer
    McBrayer Reptiles
    (440)221-8860-
    Justin@McBrayerReptiles.com

  3. #23
    BPnet Veteran
    Join Date
    08-18-2008
    Posts
    2,754
    Thanks
    710
    Thanked 737 Times in 457 Posts

    Re: Repticon, near Atlanta Jan, anyone coming?

    Quote Originally Posted by mcbrayerreptiles View Post
    Last Minute NEWS!!!
    Me and Chris From BA Reptiles will be tableing at the show this weekend!! Please stop by and introduce yourselves...I always like meeting fellow BP Neters.....Come see us!!
    I think I'm going to be over there so I look forward to seeing you.

  4. #24
    Registered User pillowtalk6188's Avatar
    Join Date
    10-30-2008
    Location
    Upstate SC
    Posts
    168
    Thanks
    4
    Thanked 23 Times in 16 Posts

    Re: Repticon, near Atlanta Jan, anyone coming?

    i'm going to try my hardest to be there saturday. my boss "accidentally" scheduled me to work that day. i'm looking for a pair of boas so i can bypass the whole shipping fee, but now i'm a little afraid of what i might find. i'm pretty sure i know how to spot a sick animal. i mean, anything wrong is visible right? like bloody vent, mites, ticks, emaciation, stuck on shed/eye caps, dents in the head, an animal cold to the touch. am i forgetting anything?

    i'm from SC by the way, i didn't know there were people in my area that were interested in reptiles. i've never met anyone in sc that kept snakes besides people i see going in and out of the pet store where i get my mice from. i'm looking for a pair of baby columbian boas, relatively cheap. there the first boas i'm adding to my small collection and also the first pair i'll be using for breeding in the future.

    anyone from SC, send me a pm, i'd love to talk.
    ____________________________________________
    0.1 corn snake
    0.1 ball python
    0.0.1 ringneck
    1.0 box turtle

    http://www.myspace.com/fishlips88

  5. #25
    Registered User grammie's Avatar
    Join Date
    11-12-2008
    Location
    in the empty nest
    Posts
    321
    Thanks
    157
    Thanked 40 Times in 33 Posts
    Images: 10

    Re: Repticon, near Atlanta Jan, anyone coming?

    take your own hand sanitizer!!!!

  6. #26
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Repticon, near Atlanta Jan, anyone coming?

    Quote Originally Posted by pillowtalk6188 View Post
    i'm from SC by the way, i didn't know there were people in my area that were interested in reptiles.
    Until this thread and the recent GA new member thread I was not aware there were so many locals. Prior to these I only knew my vet and a couple guys who share a similar interest in carnivorous plants (one of whom introduced me to Jason Brock.)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #27
    Registered User pillowtalk6188's Avatar
    Join Date
    10-30-2008
    Location
    Upstate SC
    Posts
    168
    Thanks
    4
    Thanked 23 Times in 16 Posts

    Re: Repticon, near Atlanta Jan, anyone coming?

    Quote Originally Posted by asplundii View Post
    Until this thread and the recent GA new member thread I was not aware there were so many locals. Prior to these I only knew my vet and a couple guys who share a similar interest in carnivorous plants (one of whom introduced me to Jason Brock.)
    GA new member thread? i really hope i can go saturday and meet some people in my area. it's a little frustrating living somewhere where there is nobody to talk with that shares your hobby.
    ____________________________________________
    0.1 corn snake
    0.1 ball python
    0.0.1 ringneck
    1.0 box turtle

    http://www.myspace.com/fishlips88

  8. #28
    Registered User pillowtalk6188's Avatar
    Join Date
    10-30-2008
    Location
    Upstate SC
    Posts
    168
    Thanks
    4
    Thanked 23 Times in 16 Posts

    Re: Repticon, near Atlanta Jan, anyone coming?

    i got off work, i'm coming!!!

    does anyone know a good reliable table to get Boas from?
    ____________________________________________
    0.1 corn snake
    0.1 ball python
    0.0.1 ringneck
    1.0 box turtle

    http://www.myspace.com/fishlips88

  9. #29
    Steel Magnolia rabernet's Avatar
    Join Date
    07-12-2005
    Location
    In the Nest
    Posts
    29,196
    Thanks
    2,845
    Thanked 5,584 Times in 3,092 Posts
    Blog Entries
    2
    Images: 46

    Re: Repticon, near Atlanta Jan, anyone coming?

    Quote Originally Posted by pillowtalk6188 View Post
    i'm going to try my hardest to be there saturday. my boss "accidentally" scheduled me to work that day. i'm looking for a pair of boas so i can bypass the whole shipping fee, but now i'm a little afraid of what i might find. i'm pretty sure i know how to spot a sick animal. i mean, anything wrong is visible right? like bloody vent, mites, ticks, emaciation, stuck on shed/eye caps, dents in the head, an animal cold to the touch. am i forgetting anything?

    i'm from SC by the way, i didn't know there were people in my area that were interested in reptiles. i've never met anyone in sc that kept snakes besides people i see going in and out of the pet store where i get my mice from. i'm looking for a pair of baby columbian boas, relatively cheap. there the first boas i'm adding to my small collection and also the first pair i'll be using for breeding in the future.

    anyone from SC, send me a pm, i'd love to talk.
    Not everything. Be prepared to QT any boas that you pick up in a completely opposite end of the house as your pythons - preferably in a different building, but that's not feasable for many keepers. Boas can carry IBD (Inclusion Body Disease) and not show any symptoms - for a LONG time, but a python exposed to a boa that's a carrier will succomb to IBD within a month. It is lethal very quickly to pythons, and without taking a biopsy of the liver, it's not possible to conclusively diagnose.

    As much as I would love to own a dwarf locality boa myself, I've made the decision NOT to bring boas into my collection. I would recommend that between now and Saturday you print a list of vendors from the Repticon site, and then do a search on each vendor on the BOI to see what type of reputation they have.

    Not trying to scare you any, but you should be aware of the risks when keeping both boas and pythons.

  10. #30
    Steel Magnolia rabernet's Avatar
    Join Date
    07-12-2005
    Location
    In the Nest
    Posts
    29,196
    Thanks
    2,845
    Thanked 5,584 Times in 3,092 Posts
    Blog Entries
    2
    Images: 46

    Re: Repticon, near Atlanta Jan, anyone coming?

    Deborah and I will likely be there a little after 1 pm on Saturday. We're going to meet and have lunch first, then head on over to the show. I'll probably be wearing my black shirt with Ball Pythons on the front on it.

    Aaron, what time are you going to be there? Anyone who would like to meet up at the show and think they'll be there that time, PM me for my cell phone number so we can hook up that way!

Page 3 of 5 FirstFirst 12345 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1