Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,817

0 members and 1,817 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,917
Threads: 249,119
Posts: 2,572,213
Top Poster: JLC (31,651)
Welcome to our newest member, Necbov
Page 4 of 4 FirstFirst 1234
Results 31 to 38 of 38
  1. #31
    BPnet Veteran Bundu Boy's Avatar
    Join Date
    04-13-2008
    Location
    Johannesburg, South Africa
    Posts
    312
    Thanks
    80
    Thanked 31 Times in 26 Posts
    Images: 42

    Re: Caught in the Act!! - Balls Escaping!

    Quote Originally Posted by boboso View Post
    All I know is I'm paying for my wife's stay at the St. Regis if ours got out.
    St Regis? What is that? An institute for the mentally damaged?

    My girl turns into GI Jane when one of our balls get out, she down on her belly doing a reccy under tables, chairs, racks etc...
    http://www.ballpythonssa.co.za - Home of Iron Balls Ball Pythons
    3.3 Normals - 1.2 100% Het Albino - 1.1 Spider
    0.1 Pastel - 1.0 VPI Axanthic - 0.1 VPI Het Axanthic
    1.0 Het Pied - 0.1 Pied - 0.1 Het Ghost
    0.1 Butter - 1.0 Cinnamon - 1.1 Yellow Belly
    1.0 - Super Pastel - 1.0 Ghost - 1.0 Mojave

  2. #32
    BPnet Veteran Bundu Boy's Avatar
    Join Date
    04-13-2008
    Location
    Johannesburg, South Africa
    Posts
    312
    Thanks
    80
    Thanked 31 Times in 26 Posts
    Images: 42

    Re: Caught in the Act!! - Balls Escaping!

    Anyhoo, here is the pic of Delilah trying to make her escape



    She knows that the glass door slides sideways and she knows that of she noses around that spot that she may be able to make a sneaky getaway
    http://www.ballpythonssa.co.za - Home of Iron Balls Ball Pythons
    3.3 Normals - 1.2 100% Het Albino - 1.1 Spider
    0.1 Pastel - 1.0 VPI Axanthic - 0.1 VPI Het Axanthic
    1.0 Het Pied - 0.1 Pied - 0.1 Het Ghost
    0.1 Butter - 1.0 Cinnamon - 1.1 Yellow Belly
    1.0 - Super Pastel - 1.0 Ghost - 1.0 Mojave

  3. #33
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Caught in the Act!! - Balls Escaping!

    Not exactly an escape pic as I was watching him the whole time but...

    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #34
    BPnet Veteran Purrrfect9's Avatar
    Join Date
    02-18-2007
    Location
    Oklahoma
    Posts
    1,081
    Thanks
    102
    Thanked 79 Times in 66 Posts
    Images: 10

    Re: Caught in the Act!! - Balls Escaping!

    I actualy had my 2300 gram girl get stuck inside my dad's leather couch >.< We had her out holding her, and she managed to get her head in between the cushions and got into the frame of the couch and was chillin in one of the coils. we slowly tipped the couch upside down and cut a flap open in the bottom, and like the OP did, we tickled her tail until she came out on her own. Ooooooh that was not a happy day for her! lol
    -Kasi- 'Marsupial Mom' in training!
    0.1 Normal BP ~Isis~
    1.0 Graziani Pastel ~Apollo~
    0.1 Spider ~Savannah~
    1.0 Albino ~Ra~
    1.1 Lesser Platinum's ~Osiris~ ~Cleopatra~
    2.4 PastelXNormal babies
    0.1 RTB het Anery ~Camila~
    1.1 Bennet's wallabies ~ Boomer~~Bella~
    2.1 Red Kangaroo's ~Rocky, Jack, and Ruby~
    1.0 Serval ~Keyba~

  5. #35
    BPnet Lifer wolfy-hound's Avatar
    Join Date
    10-10-2005
    Location
    Florida
    Posts
    5,505
    Thanks
    2,128
    Thanked 2,221 Times in 1,151 Posts
    Images: 23

    Re: Caught in the Act!! - Balls Escaping!

    I had Blackback get out of the original bin, and he was up on the shower curtain rod, pretending to be a amazon tree boa. The other escape was two hatchlings, out of another rubbermaid bin. I was awakened by the dogs barking and huffing for me to come to the living room. There I found a baby unconcerned about the dogs, crawling happily across the floor. She was returned to the bin. The next night, my old english sheepdog suddenly lept up in the air. The other missing baby had crawled onto her head while she was sleeping. That one was also placed back in a bin. Now that I have the rack systems, there's no more escapes.
    Theresa Baker
    No Legs and More
    Florida, USA
    "Stop being a wimpy monkey,; bare some teeth, steal some food and fling poo with the alphas. "

  6. #36
    Registered User boboso's Avatar
    Join Date
    11-17-2008
    Location
    So Cal
    Posts
    83
    Thanks
    8
    Thanked 11 Times in 11 Posts
    Images: 1

    Re: Caught in the Act!! - Balls Escaping!

    Quote Originally Posted by Bundu Boy View Post
    St Regis? What is that? An institute for the mentally damaged?

    My girl turns into GI Jane when one of our balls get out, she down on her belly doing a reccy under tables, chairs, racks etc...
    Trust me, she is not mentally damaged , though she may be if she found the snake missing from it's enclosure. The St. Regis is a high end resort down the way in Dana Point.

    One of the only things is my wife is afraid of reptiles & insects. She was a sweetheart as always in letting our son adopt a BP that needed a home. She won't touch the snake, but cares enough about teaching our boy about animals and to let us have reptiles is a big deal for her. In fact she is the one who suggested giving this BP a home.

    She laughs that if it ever escapes she will be enjoying a massage, spa and dinner while we look for the escapee. This is her way of telling us... don't let it get out without us around, and perhaps make us look really hard cause I don't want to outlay that kinda cash!

  7. #37
    BPnet Veteran Bundu Boy's Avatar
    Join Date
    04-13-2008
    Location
    Johannesburg, South Africa
    Posts
    312
    Thanks
    80
    Thanked 31 Times in 26 Posts
    Images: 42

    Re: Caught in the Act!! - Balls Escaping!

    Quote Originally Posted by boboso View Post
    Trust me, she is not mentally damaged , though she may be if she found the snake missing from it's enclosure. The St. Regis is a high end resort down the way in Dana Point.

    One of the only things is my wife is afraid of reptiles & insects. She was a sweetheart as always in letting our son adopt a BP that needed a home. She won't touch the snake, but cares enough about teaching our boy about animals and to let us have reptiles is a big deal for her. In fact she is the one who suggested giving this BP a home.

    She laughs that if it ever escapes she will be enjoying a massage, spa and dinner while we look for the escapee. This is her way of telling us... don't let it get out without us around, and perhaps make us look really hard cause I don't want to outlay that kinda cash!

    Aaah ok, gotcha.... The way you posted about St Regis I kinda took it that your wife would have a nervous breakdown or something if the ball got out.

    Be careful though, that is a nice make-good present that she'd get, make sure she don't do a sneaky and bump the cage so that the door opens.... ooops.... escaped ball python... St Regis here I come
    http://www.ballpythonssa.co.za - Home of Iron Balls Ball Pythons
    3.3 Normals - 1.2 100% Het Albino - 1.1 Spider
    0.1 Pastel - 1.0 VPI Axanthic - 0.1 VPI Het Axanthic
    1.0 Het Pied - 0.1 Pied - 0.1 Het Ghost
    0.1 Butter - 1.0 Cinnamon - 1.1 Yellow Belly
    1.0 - Super Pastel - 1.0 Ghost - 1.0 Mojave

  8. #38
    BPnet Veteran Bundu Boy's Avatar
    Join Date
    04-13-2008
    Location
    Johannesburg, South Africa
    Posts
    312
    Thanks
    80
    Thanked 31 Times in 26 Posts
    Images: 42

    Re: Caught in the Act!! - Balls Escaping!

    Quote Originally Posted by Purrrfect9 View Post
    I actualy had my 2300 gram girl get stuck inside my dad's leather couch >.< We had her out holding her, and she managed to get her head in between the cushions and got into the frame of the couch and was chillin in one of the coils. we slowly tipped the couch upside down and cut a flap open in the bottom, and like the OP did, we tickled her tail until she came out on her own. Ooooooh that was not a happy day for her! lol
    Ouch, don't fancy having to put a knife to my old mans leather couch!! I once had a pet hamster get into the bottom of my couch and boy that was a mission!!!

    Quote Originally Posted by wolfy-hound View Post
    I had Blackback get out of the original bin, and he was up on the shower curtain rod, pretending to be a amazon tree boa. The other escape was two hatchlings, out of another rubbermaid bin. I was awakened by the dogs barking and huffing for me to come to the living room. There I found a baby unconcerned about the dogs, crawling happily across the floor. She was returned to the bin. The next night, my old english sheepdog suddenly lept up in the air. The other missing baby had crawled onto her head while she was sleeping. That one was also placed back in a bin. Now that I have the rack systems, there's no more escapes.
    Man's best friend to the rescue again, those sheepdogs are super, nice intelligent animals... some dogs will try and gobble up a ball on sight... they are like animated rope toys
    http://www.ballpythonssa.co.za - Home of Iron Balls Ball Pythons
    3.3 Normals - 1.2 100% Het Albino - 1.1 Spider
    0.1 Pastel - 1.0 VPI Axanthic - 0.1 VPI Het Axanthic
    1.0 Het Pied - 0.1 Pied - 0.1 Het Ghost
    0.1 Butter - 1.0 Cinnamon - 1.1 Yellow Belly
    1.0 - Super Pastel - 1.0 Ghost - 1.0 Mojave

Page 4 of 4 FirstFirst 1234

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1