» Site Navigation
0 members and 665 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,904
Threads: 249,100
Posts: 2,572,078
Top Poster: JLC (31,651)
|
-
BPnet Veteran
0.1.0 Albino Jungle (Diva)
0.0.1 Leo Gecko(Loki)
1.0.0 Leo Gecko(Nova)
1.0.0 Spider Ball( Svita)
0.1.0 Pewter BP ( Cloud)
0.1.0 Het Orange Ghost ( Morgana)
1.0.0 Piebald ( Boo)
0.1.0 Piebald (Pandora)
0.1.0 88%IJ JAG( Halo)
1.0.0 Jungle Jag(Winter)
1.0.0. Clown ( Echo)
1.0.0 Albino Mojave ( Frost)
-
-
BPnet Veteran
0.1.0 amel het motley corn snake
0.1.0 pastel ball python
1.0.0 spider ball python
1.0.0 leopard gecko
1.1.0 Crested geckos
0.1.0 argentine black and white tegu
0.1.2 red ear slider turtle
-
-
BPnet Veteran
0.1.0 Albino Jungle (Diva)
0.0.1 Leo Gecko(Loki)
1.0.0 Leo Gecko(Nova)
1.0.0 Spider Ball( Svita)
0.1.0 Pewter BP ( Cloud)
0.1.0 Het Orange Ghost ( Morgana)
1.0.0 Piebald ( Boo)
0.1.0 Piebald (Pandora)
0.1.0 88%IJ JAG( Halo)
1.0.0 Jungle Jag(Winter)
1.0.0. Clown ( Echo)
1.0.0 Albino Mojave ( Frost)
-
-
Registered User
Re: pics of my GB Kings
Nice...I have 3 corns but thinking about getting a grey band...do they tend to musk like alot of the other kings and milksnakes
-
-
BPnet Veteran
0.1.0 Albino Jungle (Diva)
0.0.1 Leo Gecko(Loki)
1.0.0 Leo Gecko(Nova)
1.0.0 Spider Ball( Svita)
0.1.0 Pewter BP ( Cloud)
0.1.0 Het Orange Ghost ( Morgana)
1.0.0 Piebald ( Boo)
0.1.0 Piebald (Pandora)
0.1.0 88%IJ JAG( Halo)
1.0.0 Jungle Jag(Winter)
1.0.0. Clown ( Echo)
1.0.0 Albino Mojave ( Frost)
-
The Following User Says Thank You to Crusader71 For This Useful Post:
-
BPnet Veteran
Re: pics of my GB Kings
I have cal kings, MBK, and one Thayeri (milk snake phase). BUT WOWOWWOWO
very nice snakes.
Carol
-
-
BPnet Veteran
0.1.0 Albino Jungle (Diva)
0.0.1 Leo Gecko(Loki)
1.0.0 Leo Gecko(Nova)
1.0.0 Spider Ball( Svita)
0.1.0 Pewter BP ( Cloud)
0.1.0 Het Orange Ghost ( Morgana)
1.0.0 Piebald ( Boo)
0.1.0 Piebald (Pandora)
0.1.0 88%IJ JAG( Halo)
1.0.0 Jungle Jag(Winter)
1.0.0. Clown ( Echo)
1.0.0 Albino Mojave ( Frost)
-
-
BPnet Veteran
Re: pics of my GB Kings
Very nice! I like the Gray Bandeds a lot they just take so long to grow up!
~Adam~
BPs: 3.9 Normals, 1.0 Spider, 1.1 Pastels, 0.1 100% Het Hypo, 1.0 Cinnamon, 0.1 Pinstripe, 0.1 Albino 1.0 Bumblebee .
Bloods: 0.1 Marter line red, 1.0 Het T+ albino red.
Colubrids:1.1 Western Hogs, 0.0.1 Tri-Color Hognose, 1.0 Albino Cal King,
-
-
BPnet Veteran
Re: pics of my GB Kings
Do your graybands cruise around a lot?
I'm planning on getting one in February and after quarantining it in a tub I want to put it in a nice AP cage... so I hope he'll be out and about a lot.
MH
Who the hell is Pat?
"Pattimuss doesn't run, he prances most delicately, like a beautiful but sad fairy, winged and capped, curly toed shoes on each foot, dancing on dewdrops while lazy crickets play soft music for him to keep time by...." - Wes
-
-
Re: pics of my GB Kings
 Originally Posted by DutchHerp
Do your graybands cruise around a lot?
Well mine does, seems like she is always cruising around except right after she eats.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|